Incidental Mutation 'R0534:Cps1'
ID 49351
Institutional Source Beutler Lab
Gene Symbol Cps1
Ensembl Gene ENSMUSG00000025991
Gene Name carbamoyl-phosphate synthetase 1
Synonyms CPSase I, D1Ucla3, CPS, 4732433M03Rik
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0534 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 67123026-67231259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67143900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000027144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027144]
AlphaFold Q8C196
Predicted Effect probably benign
Transcript: ENSMUST00000027144
AA Change: D139G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: D139G

DomainStartEndE-ValueType
CPSase_sm_chain 44 184 2.5e-70 SMART
Pfam:GATase 221 397 1.5e-40 PFAM
low complexity region 426 436 N/A INTRINSIC
Pfam:ATP-grasp_4 543 724 6.8e-12 PFAM
Pfam:CPSase_L_D2 546 750 1.7e-85 PFAM
Pfam:ATP-grasp 554 722 4.9e-8 PFAM
Pfam:Dala_Dala_lig_C 561 718 1.5e-7 PFAM
CPSase_L_D3 839 962 1.18e-57 SMART
Pfam:ATP-grasp_4 1085 1264 1e-19 PFAM
Pfam:CPSase_L_D2 1088 1291 7.4e-32 PFAM
Pfam:Dala_Dala_lig_C 1095 1279 1.6e-6 PFAM
Pfam:ATP-grasp 1096 1263 2.8e-12 PFAM
MGS 1373 1465 1.53e-15 SMART
Meta Mutation Damage Score 0.0757 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 (GRCm38) E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 (GRCm38) S32* probably null Het
Cand2 A G 6: 115,787,236 (GRCm38) M324V probably damaging Het
Cap1 C T 4: 122,862,719 (GRCm38) V340M probably benign Het
Ccdc110 T C 8: 45,935,138 (GRCm38) V44A possibly damaging Het
Cwc27 T A 13: 104,631,616 (GRCm38) E457V unknown Het
Cxxc1 C T 18: 74,218,891 (GRCm38) P280S probably benign Het
Dopey2 T A 16: 93,762,505 (GRCm38) L595Q probably benign Het
Dscam G T 16: 96,652,172 (GRCm38) S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 (GRCm38) F353L probably damaging Het
Ep300 A G 15: 81,600,896 (GRCm38) probably benign Het
Fads1 C T 19: 10,183,065 (GRCm38) P5L probably benign Het
Fign T A 2: 63,980,791 (GRCm38) H45L probably damaging Het
Flcn T A 11: 59,794,199 (GRCm38) probably benign Het
Gm5141 A T 13: 62,774,594 (GRCm38) F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 (GRCm38) N402K probably damaging Het
Gpr37 A T 6: 25,669,824 (GRCm38) C340* probably null Het
Gtf3c2 A T 5: 31,158,132 (GRCm38) probably benign Het
Hcfc2 T A 10: 82,738,408 (GRCm38) F139I probably damaging Het
Hectd4 T C 5: 121,348,476 (GRCm38) L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 (GRCm38) probably benign Het
Igf2bp1 A G 11: 95,966,796 (GRCm38) probably benign Het
Igsf9b T G 9: 27,333,062 (GRCm38) probably null Het
Il23r G A 6: 67,426,588 (GRCm38) A443V probably benign Het
Kcnv1 A G 15: 45,109,249 (GRCm38) F413L probably damaging Het
Lipe C A 7: 25,388,186 (GRCm38) A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 (GRCm38) S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 (GRCm38) W13L probably damaging Het
Myrf G C 19: 10,218,162 (GRCm38) T428S probably benign Het
Npy1r C A 8: 66,705,018 (GRCm38) Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 (GRCm38) R168H probably benign Het
Osbpl10 C T 9: 115,167,178 (GRCm38) L139F probably damaging Het
P2rx6 A C 16: 17,567,904 (GRCm38) T199P probably damaging Het
Phyhip A T 14: 70,461,759 (GRCm38) M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 (GRCm38) D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 (GRCm38) I342N possibly damaging Het
Reln A T 5: 21,947,408 (GRCm38) D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 (GRCm38) E294G probably benign Het
Scnn1g A G 7: 121,767,424 (GRCm38) M615V probably benign Het
Shcbp1l T A 1: 153,428,568 (GRCm38) D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 (GRCm38) S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 (GRCm38) probably benign Het
St5 A T 7: 109,541,428 (GRCm38) V197D probably damaging Het
Timp4 A G 6: 115,249,841 (GRCm38) Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 (GRCm38) L459Q probably benign Het
Tmem104 C A 11: 115,200,828 (GRCm38) T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 (GRCm38) probably benign Het
Zfp622 A T 15: 25,984,568 (GRCm38) I7F possibly damaging Het
Other mutations in Cps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Cps1 APN 1 67,152,380 (GRCm38) splice site probably benign
IGL00897:Cps1 APN 1 67,215,564 (GRCm38) missense probably benign 0.08
IGL00928:Cps1 APN 1 67,123,234 (GRCm38) missense probably benign
IGL01063:Cps1 APN 1 67,195,166 (GRCm38) missense possibly damaging 0.91
IGL01081:Cps1 APN 1 67,206,824 (GRCm38) missense probably damaging 1.00
IGL01361:Cps1 APN 1 67,195,145 (GRCm38) missense probably benign 0.03
IGL01396:Cps1 APN 1 67,157,786 (GRCm38) missense probably damaging 1.00
IGL01516:Cps1 APN 1 67,230,284 (GRCm38) missense probably damaging 0.99
IGL01695:Cps1 APN 1 67,197,035 (GRCm38) missense probably benign
IGL02022:Cps1 APN 1 67,172,872 (GRCm38) splice site probably benign
IGL02032:Cps1 APN 1 67,230,315 (GRCm38) missense probably benign 0.03
IGL02049:Cps1 APN 1 67,143,954 (GRCm38) missense possibly damaging 0.68
IGL02197:Cps1 APN 1 67,157,764 (GRCm38) missense probably benign
IGL02217:Cps1 APN 1 67,174,382 (GRCm38) missense probably benign 0.06
IGL02555:Cps1 APN 1 67,214,021 (GRCm38) missense probably benign 0.06
IGL02570:Cps1 APN 1 67,148,703 (GRCm38) splice site probably benign
IGL02633:Cps1 APN 1 67,123,237 (GRCm38) missense probably benign
IGL02711:Cps1 APN 1 67,212,517 (GRCm38) splice site probably benign
IGL02737:Cps1 APN 1 67,148,774 (GRCm38) missense probably benign 0.35
IGL03030:Cps1 APN 1 67,142,921 (GRCm38) missense probably damaging 1.00
IGL03255:Cps1 APN 1 67,145,801 (GRCm38) nonsense probably null
Madman UTSW 1 67,160,871 (GRCm38) missense probably damaging 0.96
maniac UTSW 1 67,157,878 (GRCm38) critical splice donor site probably null
R0109:Cps1 UTSW 1 67,229,418 (GRCm38) missense possibly damaging 0.82
R0109:Cps1 UTSW 1 67,229,418 (GRCm38) missense possibly damaging 0.82
R0140:Cps1 UTSW 1 67,180,116 (GRCm38) missense probably benign
R0318:Cps1 UTSW 1 67,177,014 (GRCm38) missense probably damaging 0.99
R0486:Cps1 UTSW 1 67,165,392 (GRCm38) missense probably damaging 1.00
R0488:Cps1 UTSW 1 67,148,808 (GRCm38) splice site probably benign
R0492:Cps1 UTSW 1 67,157,836 (GRCm38) missense probably damaging 1.00
R0521:Cps1 UTSW 1 67,215,564 (GRCm38) missense probably benign 0.02
R0565:Cps1 UTSW 1 67,166,449 (GRCm38) missense possibly damaging 0.57
R0609:Cps1 UTSW 1 67,172,802 (GRCm38) missense probably damaging 1.00
R0612:Cps1 UTSW 1 67,139,770 (GRCm38) missense probably benign 0.01
R1185:Cps1 UTSW 1 67,195,199 (GRCm38) missense probably benign 0.00
R1185:Cps1 UTSW 1 67,195,199 (GRCm38) missense probably benign 0.00
R1185:Cps1 UTSW 1 67,195,199 (GRCm38) missense probably benign 0.00
R1220:Cps1 UTSW 1 67,204,703 (GRCm38) critical splice donor site probably null
R1321:Cps1 UTSW 1 67,143,019 (GRCm38) splice site probably benign
R1343:Cps1 UTSW 1 67,209,609 (GRCm38) missense probably damaging 1.00
R1373:Cps1 UTSW 1 67,229,424 (GRCm38) missense possibly damaging 0.89
R1374:Cps1 UTSW 1 67,230,281 (GRCm38) missense probably damaging 0.97
R1481:Cps1 UTSW 1 67,143,882 (GRCm38) missense probably damaging 0.99
R1711:Cps1 UTSW 1 67,168,374 (GRCm38) splice site probably null
R1712:Cps1 UTSW 1 67,230,281 (GRCm38) missense probably damaging 0.97
R1774:Cps1 UTSW 1 67,170,882 (GRCm38) missense possibly damaging 0.94
R1799:Cps1 UTSW 1 67,209,642 (GRCm38) missense probably damaging 1.00
R1954:Cps1 UTSW 1 67,195,196 (GRCm38) missense possibly damaging 0.71
R2074:Cps1 UTSW 1 67,204,638 (GRCm38) missense probably benign 0.21
R2078:Cps1 UTSW 1 67,195,265 (GRCm38) missense possibly damaging 0.74
R2078:Cps1 UTSW 1 67,157,806 (GRCm38) missense probably damaging 1.00
R2111:Cps1 UTSW 1 67,176,980 (GRCm38) missense probably benign 0.01
R2112:Cps1 UTSW 1 67,176,980 (GRCm38) missense probably benign 0.01
R2146:Cps1 UTSW 1 67,152,379 (GRCm38) splice site probably benign
R2355:Cps1 UTSW 1 67,156,224 (GRCm38) missense probably damaging 1.00
R2375:Cps1 UTSW 1 67,217,860 (GRCm38) missense probably benign 0.00
R2860:Cps1 UTSW 1 67,166,375 (GRCm38) missense probably benign 0.44
R2861:Cps1 UTSW 1 67,166,375 (GRCm38) missense probably benign 0.44
R2979:Cps1 UTSW 1 67,204,704 (GRCm38) critical splice donor site probably null
R3427:Cps1 UTSW 1 67,174,494 (GRCm38) missense probably damaging 1.00
R3833:Cps1 UTSW 1 67,139,787 (GRCm38) missense probably damaging 1.00
R3857:Cps1 UTSW 1 67,168,278 (GRCm38) missense probably damaging 1.00
R3858:Cps1 UTSW 1 67,168,278 (GRCm38) missense probably damaging 1.00
R3859:Cps1 UTSW 1 67,168,278 (GRCm38) missense probably damaging 1.00
R3886:Cps1 UTSW 1 67,165,500 (GRCm38) missense possibly damaging 0.83
R3887:Cps1 UTSW 1 67,165,500 (GRCm38) missense possibly damaging 0.83
R3888:Cps1 UTSW 1 67,165,500 (GRCm38) missense possibly damaging 0.83
R3889:Cps1 UTSW 1 67,165,500 (GRCm38) missense possibly damaging 0.83
R4386:Cps1 UTSW 1 67,170,995 (GRCm38) critical splice donor site probably null
R4497:Cps1 UTSW 1 67,205,199 (GRCm38) missense probably null 1.00
R4671:Cps1 UTSW 1 67,196,560 (GRCm38) missense probably damaging 1.00
R4774:Cps1 UTSW 1 67,220,512 (GRCm38) missense probably damaging 0.99
R4799:Cps1 UTSW 1 67,142,986 (GRCm38) missense probably damaging 0.96
R4853:Cps1 UTSW 1 67,156,202 (GRCm38) missense possibly damaging 0.51
R4884:Cps1 UTSW 1 67,177,024 (GRCm38) missense probably benign 0.11
R4900:Cps1 UTSW 1 67,160,904 (GRCm38) missense probably damaging 1.00
R4906:Cps1 UTSW 1 67,139,763 (GRCm38) missense probably benign 0.10
R5091:Cps1 UTSW 1 67,229,520 (GRCm38) critical splice donor site probably null
R5102:Cps1 UTSW 1 67,206,793 (GRCm38) missense probably benign 0.00
R5215:Cps1 UTSW 1 67,166,380 (GRCm38) missense possibly damaging 0.62
R5290:Cps1 UTSW 1 67,172,709 (GRCm38) missense probably benign 0.21
R5732:Cps1 UTSW 1 67,157,764 (GRCm38) missense probably benign 0.22
R5818:Cps1 UTSW 1 67,166,488 (GRCm38) missense possibly damaging 0.96
R5878:Cps1 UTSW 1 67,157,878 (GRCm38) critical splice donor site probably null
R6002:Cps1 UTSW 1 67,172,755 (GRCm38) missense possibly damaging 0.94
R6034:Cps1 UTSW 1 67,157,713 (GRCm38) splice site probably null
R6034:Cps1 UTSW 1 67,157,713 (GRCm38) splice site probably null
R6199:Cps1 UTSW 1 67,162,615 (GRCm38) frame shift probably null
R6310:Cps1 UTSW 1 67,142,981 (GRCm38) missense probably benign 0.00
R6554:Cps1 UTSW 1 67,174,469 (GRCm38) nonsense probably null
R6700:Cps1 UTSW 1 67,229,523 (GRCm38) splice site probably null
R6731:Cps1 UTSW 1 67,160,871 (GRCm38) missense probably damaging 0.96
R7052:Cps1 UTSW 1 67,198,410 (GRCm38) missense probably damaging 1.00
R7278:Cps1 UTSW 1 67,170,921 (GRCm38) missense probably damaging 1.00
R7313:Cps1 UTSW 1 67,198,358 (GRCm38) missense probably damaging 0.99
R7323:Cps1 UTSW 1 67,157,869 (GRCm38) missense probably benign 0.03
R7339:Cps1 UTSW 1 67,197,015 (GRCm38) missense possibly damaging 0.64
R7485:Cps1 UTSW 1 67,139,857 (GRCm38) missense probably damaging 1.00
R7505:Cps1 UTSW 1 67,180,081 (GRCm38) missense probably benign
R7748:Cps1 UTSW 1 67,139,806 (GRCm38) missense probably damaging 1.00
R7853:Cps1 UTSW 1 67,174,481 (GRCm38) missense possibly damaging 0.92
R8097:Cps1 UTSW 1 67,228,270 (GRCm38) missense probably benign 0.08
R8357:Cps1 UTSW 1 67,156,854 (GRCm38) missense probably damaging 1.00
R8435:Cps1 UTSW 1 67,212,430 (GRCm38) missense probably benign 0.07
R8457:Cps1 UTSW 1 67,156,854 (GRCm38) missense probably damaging 1.00
R8680:Cps1 UTSW 1 67,204,613 (GRCm38) missense probably damaging 1.00
R8805:Cps1 UTSW 1 67,176,951 (GRCm38) missense probably damaging 1.00
R8811:Cps1 UTSW 1 67,214,087 (GRCm38) missense probably benign 0.03
R8819:Cps1 UTSW 1 67,228,280 (GRCm38) missense possibly damaging 0.56
R8820:Cps1 UTSW 1 67,228,280 (GRCm38) missense possibly damaging 0.56
R8854:Cps1 UTSW 1 67,160,889 (GRCm38) missense probably damaging 1.00
R9138:Cps1 UTSW 1 67,215,410 (GRCm38) missense probably damaging 1.00
R9185:Cps1 UTSW 1 67,209,672 (GRCm38) missense probably benign 0.08
R9273:Cps1 UTSW 1 67,152,286 (GRCm38) missense possibly damaging 0.69
R9286:Cps1 UTSW 1 67,158,871 (GRCm38) missense probably damaging 0.99
R9308:Cps1 UTSW 1 67,160,959 (GRCm38) critical splice donor site probably null
R9326:Cps1 UTSW 1 67,209,636 (GRCm38) missense probably damaging 1.00
R9449:Cps1 UTSW 1 67,220,512 (GRCm38) missense probably damaging 0.99
R9454:Cps1 UTSW 1 67,180,152 (GRCm38) missense probably damaging 0.97
R9518:Cps1 UTSW 1 67,220,503 (GRCm38) missense probably damaging 1.00
R9564:Cps1 UTSW 1 67,158,889 (GRCm38) missense probably benign 0.26
R9585:Cps1 UTSW 1 67,156,182 (GRCm38) missense probably damaging 0.99
R9618:Cps1 UTSW 1 67,157,816 (GRCm38) missense possibly damaging 0.87
R9641:Cps1 UTSW 1 67,195,183 (GRCm38) missense probably benign 0.03
R9650:Cps1 UTSW 1 67,215,477 (GRCm38) missense
R9668:Cps1 UTSW 1 67,174,490 (GRCm38) missense probably benign 0.24
R9726:Cps1 UTSW 1 67,156,236 (GRCm38) missense probably benign 0.39
X0024:Cps1 UTSW 1 67,123,247 (GRCm38) missense probably benign
Z1176:Cps1 UTSW 1 67,148,719 (GRCm38) frame shift probably null
Z1176:Cps1 UTSW 1 67,123,268 (GRCm38) missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- GCCTGCAAGGCAAACTCACTTTC -3'
(R):5'- GACTATGTGCCCTACACACAGAGC -3'

Sequencing Primer
(F):5'- CTCACTTTCCAAAAGTAGCATTAAGG -3'
(R):5'- GCGCCATCTAGTGGATAAACTG -3'
Posted On 2013-06-12