Incidental Mutation 'R0534:Fign'
ID49353
Institutional Source Beutler Lab
Gene Symbol Fign
Ensembl Gene ENSMUSG00000075324
Gene Namefidgetin
Synonyms
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0534 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location63971507-64098038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63980791 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 45 (H45L)
Ref Sequence ENSEMBL: ENSMUSP00000122855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102728] [ENSMUST00000131615]
Predicted Effect probably benign
Transcript: ENSMUST00000102728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126042
Predicted Effect probably damaging
Transcript: ENSMUST00000131615
AA Change: H45L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122855
Gene: ENSMUSG00000075324
AA Change: H45L

DomainStartEndE-ValueType
low complexity region 204 235 N/A INTRINSIC
low complexity region 243 254 N/A INTRINSIC
low complexity region 259 291 N/A INTRINSIC
AAA 518 654 7.03e-12 SMART
Pfam:Vps4_C 708 756 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153538
Meta Mutation Damage Score 0.1450 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Homozygotes for a reporter allele show pre- and postnatal death, head-shaking, and small eyes. Spontaneous mutants show head-shaking, circling, reduced or absent semicircular canals, small abnormal eyes, aberrant cell-cycling, female sterility, and low prenetrance craniofacial and skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Fign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Fign APN 2 63979010 missense probably damaging 0.99
IGL01149:Fign APN 2 63979760 missense possibly damaging 0.92
IGL01328:Fign APN 2 63978872 missense probably damaging 0.97
IGL01448:Fign APN 2 63979688 missense probably damaging 0.97
IGL01680:Fign APN 2 63978644 utr 3 prime probably benign
IGL01989:Fign APN 2 63980450 missense probably benign
IGL02010:Fign APN 2 63980400 missense probably damaging 0.98
IGL02092:Fign APN 2 63980583 missense possibly damaging 0.95
IGL02252:Fign APN 2 63980639 missense probably benign 0.14
IGL02455:Fign APN 2 63980497 missense probably benign 0.22
IGL02541:Fign APN 2 63979537 missense probably benign 0.38
IGL03109:Fign APN 2 63980662 missense possibly damaging 0.83
R0630:Fign UTSW 2 63980141 missense possibly damaging 0.86
R1678:Fign UTSW 2 63980374 missense probably damaging 0.99
R2512:Fign UTSW 2 63979799 missense probably benign 0.03
R3125:Fign UTSW 2 63978700 missense possibly damaging 0.94
R4679:Fign UTSW 2 63979261 missense probably damaging 1.00
R4735:Fign UTSW 2 63980438 missense probably damaging 1.00
R4753:Fign UTSW 2 63979019 missense probably benign 0.04
R5071:Fign UTSW 2 63979693 nonsense probably null
R5072:Fign UTSW 2 63979693 nonsense probably null
R5073:Fign UTSW 2 63979693 nonsense probably null
R5074:Fign UTSW 2 63979693 nonsense probably null
R5344:Fign UTSW 2 63979225 missense probably benign 0.01
R5427:Fign UTSW 2 63978998 missense probably damaging 1.00
R5922:Fign UTSW 2 63979060 missense probably damaging 0.99
R6115:Fign UTSW 2 63979310 missense probably benign 0.22
R6373:Fign UTSW 2 63979645 missense probably benign 0.06
R6542:Fign UTSW 2 63980295 missense possibly damaging 0.53
R6637:Fign UTSW 2 64027908 intron probably benign
R6858:Fign UTSW 2 63979813 missense probably benign 0.02
R7188:Fign UTSW 2 63979606 missense possibly damaging 0.95
R7309:Fign UTSW 2 63979957 missense possibly damaging 0.77
R7429:Fign UTSW 2 63979060 missense probably damaging 0.99
R7430:Fign UTSW 2 63979060 missense probably damaging 0.99
R7608:Fign UTSW 2 63978719 missense possibly damaging 0.75
R7642:Fign UTSW 2 63980572 missense probably benign 0.16
R7782:Fign UTSW 2 63979162 missense probably damaging 1.00
X0028:Fign UTSW 2 63980851 missense probably damaging 1.00
Z1088:Fign UTSW 2 64096902 missense probably benign 0.01
Z1177:Fign UTSW 2 63979385 missense probably damaging 1.00
Z1177:Fign UTSW 2 63979690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCGACCATTCACGAGTCCTGATG -3'
(R):5'- ACCTGGGAAGATTCTTATCCACCTCC -3'

Sequencing Primer
(F):5'- CCTGATGGTGTGTCTGAATAATTGC -3'
(R):5'- CCACCTCCATATTGTTAGTGGAAG -3'
Posted On2013-06-12