Incidental Mutation 'R0534:Cap1'
ID49357
Institutional Source Beutler Lab
Gene Symbol Cap1
Ensembl Gene ENSMUSG00000028656
Gene NameCAP, adenylate cyclase-associated protein 1 (yeast)
Synonyms
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R0534 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location122859047-122886056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122862719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 340 (V340M)
Ref Sequence ENSEMBL: ENSMUSP00000101864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030412] [ENSMUST00000069533] [ENSMUST00000106255] [ENSMUST00000106257] [ENSMUST00000120157] [ENSMUST00000128485]
Predicted Effect probably benign
Transcript: ENSMUST00000030412
SMART Domains Protein: ENSMUSP00000030412
Gene: ENSMUSG00000028657

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Palm_thioest 28 306 3.6e-208 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069533
AA Change: V340M

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000068260
Gene: ENSMUSG00000028656
AA Change: V340M

DomainStartEndE-ValueType
Pfam:CAP_N 4 304 1e-129 PFAM
CARP 355 392 2.09e-9 SMART
CARP 393 430 1.18e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106255
AA Change: V340M

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101862
Gene: ENSMUSG00000028656
AA Change: V340M

DomainStartEndE-ValueType
Pfam:CAP_N 5 294 4.2e-116 PFAM
CARP 355 392 2.09e-9 SMART
CARP 393 430 1.18e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106257
AA Change: V340M

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101864
Gene: ENSMUSG00000028656
AA Change: V340M

DomainStartEndE-ValueType
Pfam:CAP_N 4 304 1e-129 PFAM
CARP 355 392 2.09e-9 SMART
CARP 393 430 1.18e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120157
SMART Domains Protein: ENSMUSP00000113258
Gene: ENSMUSG00000028657

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128485
SMART Domains Protein: ENSMUSP00000114847
Gene: ENSMUSG00000028656

DomainStartEndE-ValueType
Pfam:CAP_N 4 164 2.3e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150919
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: The product of this gene plays a role in regulating actin dynamics by binding actin monomers and promoting the turnover of actin filaments. Reduced expression of this gene causes a reduction in actin filament turnover rates, causing multiple defects, including an increase in cell size, stress-fiber alterations, and defects in endocytosis and cell motility. A pseudogene of this gene is found on chromosome 14. Alternative splicing results in multiple transcript variants, but does not affect the protein. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Cap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Cap1 APN 4 122860187 missense probably damaging 0.99
IGL02163:Cap1 APN 4 122862416 missense probably benign 0.00
R0115:Cap1 UTSW 4 122863075 missense possibly damaging 0.94
R0119:Cap1 UTSW 4 122867699 missense probably damaging 1.00
R0481:Cap1 UTSW 4 122863075 missense possibly damaging 0.94
R0602:Cap1 UTSW 4 122872409 missense probably damaging 1.00
R0846:Cap1 UTSW 4 122862899 critical splice donor site probably null
R1311:Cap1 UTSW 4 122865214 missense possibly damaging 0.89
R2027:Cap1 UTSW 4 122862893 unclassified probably benign
R2446:Cap1 UTSW 4 122864608 missense probably benign 0.22
R2860:Cap1 UTSW 4 122864725 missense probably benign 0.01
R2861:Cap1 UTSW 4 122864725 missense probably benign 0.01
R2862:Cap1 UTSW 4 122864725 missense probably benign 0.01
R3690:Cap1 UTSW 4 122864626 missense probably damaging 0.98
R3691:Cap1 UTSW 4 122864626 missense probably damaging 0.98
R4089:Cap1 UTSW 4 122862409 missense probably benign 0.05
R4362:Cap1 UTSW 4 122862987 missense probably benign 0.00
R5511:Cap1 UTSW 4 122862790 unclassified probably benign
R6252:Cap1 UTSW 4 122872400 missense probably benign 0.37
R7001:Cap1 UTSW 4 122864615 missense probably benign 0.12
R7709:Cap1 UTSW 4 122862674 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCCTTAAAGAGCCAACTTCTGCC -3'
(R):5'- GTGAGTTAAAGCAGCCTGACTCCG -3'

Sequencing Primer
(F):5'- TGGAGAATCAGATTCCTGCC -3'
(R):5'- TGACTCCGGGAAGGGAC -3'
Posted On2013-06-12