Incidental Mutation 'R0534:Gtf3c2'
ID49359
Institutional Source Beutler Lab
Gene Symbol Gtf3c2
Ensembl Gene ENSMUSG00000106864
Gene Namegeneral transcription factor IIIC, polypeptide 2, beta
SynonymsTFIIIC110, 2610510G03Rik, TFIIIC-BETA, 1300004C11Rik
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R0534 (G1)
Quality Score192
Status Validated
Chromosome5
Chromosomal Location31156005-31180144 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 31158132 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088010] [ENSMUST00000101411] [ENSMUST00000154241] [ENSMUST00000200744] [ENSMUST00000200833] [ENSMUST00000200864] [ENSMUST00000201353] [ENSMUST00000201491] [ENSMUST00000202639] [ENSMUST00000202241]
Predicted Effect probably benign
Transcript: ENSMUST00000043161
SMART Domains Protein: ENSMUSP00000047210
Gene: ENSMUSG00000029144

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088010
SMART Domains Protein: ENSMUSP00000085325
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
WD40 821 861 5.33e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101411
SMART Domains Protein: ENSMUSP00000098957
Gene: ENSMUSG00000101678

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
Blast:WD40 807 844 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136581
Predicted Effect probably benign
Transcript: ENSMUST00000154241
SMART Domains Protein: ENSMUSP00000115292
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 175 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200744
SMART Domains Protein: ENSMUSP00000143843
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 103 163 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200833
SMART Domains Protein: ENSMUSP00000144324
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200864
SMART Domains Protein: ENSMUSP00000144331
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201087
Predicted Effect probably benign
Transcript: ENSMUST00000201353
SMART Domains Protein: ENSMUSP00000144198
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201423
Predicted Effect probably benign
Transcript: ENSMUST00000201491
SMART Domains Protein: ENSMUSP00000144593
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 155 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202639
SMART Domains Protein: ENSMUSP00000144489
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202203
Predicted Effect probably benign
Transcript: ENSMUST00000202241
SMART Domains Protein: ENSMUSP00000144119
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Gtf3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Gtf3c2 APN 5 31174408 missense probably damaging 1.00
IGL00832:Gtf3c2 APN 5 31173005 unclassified probably benign
IGL00904:Gtf3c2 APN 5 31172858 missense probably damaging 1.00
IGL00966:Gtf3c2 APN 5 31170173 critical splice donor site probably benign 0.00
IGL01061:Gtf3c2 APN 5 31168354 missense possibly damaging 0.94
IGL01148:Gtf3c2 APN 5 31159824 missense probably damaging 1.00
IGL01767:Gtf3c2 APN 5 31157635 missense probably benign 0.08
IGL02237:Gtf3c2 APN 5 31159053 splice site probably benign
IGL02458:Gtf3c2 APN 5 31159523 critical splice acceptor site probably null
IGL02888:Gtf3c2 APN 5 31173825 missense probably damaging 1.00
IGL03035:Gtf3c2 APN 5 31166014 missense possibly damaging 0.96
IGL03131:Gtf3c2 APN 5 31157620 missense probably damaging 0.98
R0581:Gtf3c2 UTSW 5 31159518 nonsense probably null
R0634:Gtf3c2 UTSW 5 31159806 nonsense probably null
R1172:Gtf3c2 UTSW 5 31168075 missense probably damaging 1.00
R1511:Gtf3c2 UTSW 5 31159102 missense probably benign 0.15
R1680:Gtf3c2 UTSW 5 31173868 missense probably damaging 1.00
R1726:Gtf3c2 UTSW 5 31169123 missense possibly damaging 0.82
R1831:Gtf3c2 UTSW 5 31168369 missense probably damaging 1.00
R2006:Gtf3c2 UTSW 5 31168096 missense probably damaging 0.99
R2437:Gtf3c2 UTSW 5 31159698 critical splice donor site probably null
R4732:Gtf3c2 UTSW 5 31160057 missense probably damaging 0.97
R4733:Gtf3c2 UTSW 5 31160057 missense probably damaging 0.97
R4787:Gtf3c2 UTSW 5 31157577 missense probably benign 0.03
R4817:Gtf3c2 UTSW 5 31174090 critical splice acceptor site probably null
R4863:Gtf3c2 UTSW 5 31159233 intron probably benign
R4926:Gtf3c2 UTSW 5 31169123 missense possibly damaging 0.82
R5508:Gtf3c2 UTSW 5 31174461 nonsense probably null
R5704:Gtf3c2 UTSW 5 31159110 missense probably damaging 1.00
R5737:Gtf3c2 UTSW 5 31168249 critical splice donor site probably null
R5868:Gtf3c2 UTSW 5 31168081 missense possibly damaging 0.94
R6174:Gtf3c2 UTSW 5 31158211 missense probably damaging 1.00
R6705:Gtf3c2 UTSW 5 31166008 missense possibly damaging 0.93
R6782:Gtf3c2 UTSW 5 31169836 missense probably benign 0.01
R6893:Gtf3c2 UTSW 5 31166378 missense probably benign 0.06
R7363:Gtf3c2 UTSW 5 31170256 missense probably damaging 1.00
R7474:Gtf3c2 UTSW 5 31167756 missense probably damaging 1.00
R7578:Gtf3c2 UTSW 5 31172997 missense probably benign
R7685:Gtf3c2 UTSW 5 31168267 missense probably damaging 1.00
R7711:Gtf3c2 UTSW 5 31170189 missense probably damaging 1.00
R7754:Gtf3c2 UTSW 5 31172831 missense probably benign 0.38
R7825:Gtf3c2 UTSW 5 31158371 missense probably damaging 0.99
R7994:Gtf3c2 UTSW 5 31169873 missense possibly damaging 0.60
R8430:Gtf3c2 UTSW 5 31173059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCAGCCATCCATAGGAGTCCAG -3'
(R):5'- GATTTGATACCATACCAGGACAGCCC -3'

Sequencing Primer
(F):5'- cacacctttcatctcagcaatc -3'
(R):5'- CACTACTTGCTCTTTCAAGATACAG -3'
Posted On2013-06-12