Incidental Mutation 'R0534:Gtf3c2'
ID 49359
Institutional Source Beutler Lab
Gene Symbol Gtf3c2
Ensembl Gene ENSMUSG00000106864
Gene Name general transcription factor IIIC, polypeptide 2, beta
Synonyms 2610510G03Rik, 1300004C11Rik, TFIIIC110, TFIIIC-BETA
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.578) question?
Stock # R0534 (G1)
Quality Score 192
Status Validated
Chromosome 5
Chromosomal Location 31313350-31337488 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 31315476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088010] [ENSMUST00000101411] [ENSMUST00000154241] [ENSMUST00000200744] [ENSMUST00000202639] [ENSMUST00000200864] [ENSMUST00000202241] [ENSMUST00000200833] [ENSMUST00000201491] [ENSMUST00000201353]
AlphaFold Q8BL74
Predicted Effect probably benign
Transcript: ENSMUST00000043161
SMART Domains Protein: ENSMUSP00000047210
Gene: ENSMUSG00000029144

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088010
SMART Domains Protein: ENSMUSP00000085325
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
WD40 821 861 5.33e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101411
SMART Domains Protein: ENSMUSP00000098957
Gene: ENSMUSG00000101678

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 207 225 N/A INTRINSIC
low complexity region 249 268 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
WD40 452 508 6.39e0 SMART
WD40 530 580 1.6e0 SMART
WD40 598 638 3.37e-6 SMART
Blast:WD40 807 844 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136581
Predicted Effect probably benign
Transcript: ENSMUST00000154241
SMART Domains Protein: ENSMUSP00000115292
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 108 175 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200744
SMART Domains Protein: ENSMUSP00000143843
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 103 163 5.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201423
Predicted Effect probably benign
Transcript: ENSMUST00000202639
SMART Domains Protein: ENSMUSP00000144489
Gene: ENSMUSG00000106864

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
low complexity region 144 159 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
low complexity region 292 311 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
WD40 495 551 6.39e0 SMART
WD40 573 623 1.6e0 SMART
WD40 641 681 3.37e-6 SMART
WD40 864 904 5.33e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202203
Predicted Effect probably benign
Transcript: ENSMUST00000200864
SMART Domains Protein: ENSMUSP00000144331
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202241
SMART Domains Protein: ENSMUSP00000144119
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 176 4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200833
SMART Domains Protein: ENSMUSP00000144324
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201491
SMART Domains Protein: ENSMUSP00000144593
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 155 4.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201353
SMART Domains Protein: ENSMUSP00000144198
Gene: ENSMUSG00000107283

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
Pfam:Mpv17_PMP22 109 174 1.7e-27 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cand2 A G 6: 115,764,197 (GRCm39) M324V probably damaging Het
Cap1 C T 4: 122,756,512 (GRCm39) V340M probably benign Het
Ccdc110 T C 8: 46,388,175 (GRCm39) V44A possibly damaging Het
Cps1 A G 1: 67,183,059 (GRCm39) D139G probably benign Het
Cwc27 T A 13: 104,768,124 (GRCm39) E457V unknown Het
Cxxc1 C T 18: 74,351,962 (GRCm39) P280S probably benign Het
Dennd2b A T 7: 109,140,635 (GRCm39) V197D probably damaging Het
Dop1b T A 16: 93,559,393 (GRCm39) L595Q probably benign Het
Dscam G T 16: 96,453,372 (GRCm39) S1292R possibly damaging Het
E2f4 C A 8: 106,030,851 (GRCm39) F353L probably damaging Het
Ep300 A G 15: 81,485,097 (GRCm39) probably benign Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
Fign T A 2: 63,811,135 (GRCm39) H45L probably damaging Het
Flcn T A 11: 59,685,025 (GRCm39) probably benign Het
Gm5141 A T 13: 62,922,408 (GRCm39) F254I probably damaging Het
Gpbp1l1 T A 4: 116,448,465 (GRCm39) N402K probably damaging Het
Gpr37 A T 6: 25,669,823 (GRCm39) C340* probably null Het
Hcfc2 T A 10: 82,574,242 (GRCm39) F139I probably damaging Het
Hectd4 T C 5: 121,486,539 (GRCm39) L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 44,986,659 (GRCm39) probably benign Het
Igf2bp1 A G 11: 95,857,622 (GRCm39) probably benign Het
Igsf9b T G 9: 27,244,358 (GRCm39) probably null Het
Il23r G A 6: 67,403,572 (GRCm39) A443V probably benign Het
Kcnv1 A G 15: 44,972,645 (GRCm39) F413L probably damaging Het
Lipe C A 7: 25,087,611 (GRCm39) A150S possibly damaging Het
Lrrcc1 T C 3: 14,622,333 (GRCm39) S557P probably damaging Het
Mrpl54 C A 10: 81,102,687 (GRCm39) W13L probably damaging Het
Mtcl3 T A 10: 29,056,952 (GRCm39) probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Npy1r C A 8: 67,157,670 (GRCm39) Q327K probably damaging Het
Nt5el C A 13: 105,218,762 (GRCm39) S32* probably null Het
Or51b17 C T 7: 103,542,438 (GRCm39) R168H probably benign Het
Osbpl10 C T 9: 114,996,246 (GRCm39) L139F probably damaging Het
P2rx6 A C 16: 17,385,768 (GRCm39) T199P probably damaging Het
Phyhip A T 14: 70,699,199 (GRCm39) M1L possibly damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Psmc1 T A 12: 100,086,389 (GRCm39) I342N possibly damaging Het
Reln A T 5: 22,152,406 (GRCm39) D2353E probably damaging Het
Rmdn3 T C 2: 118,976,851 (GRCm39) E294G probably benign Het
Scnn1g A G 7: 121,366,647 (GRCm39) M615V probably benign Het
Shcbp1l T A 1: 153,304,314 (GRCm39) D124E possibly damaging Het
Sipa1l1 T C 12: 82,472,054 (GRCm39) S1345P possibly damaging Het
Taf7l2 T C 10: 115,948,707 (GRCm39) E273G possibly damaging Het
Timp4 A G 6: 115,226,802 (GRCm39) Y114H probably damaging Het
Tlr9 T A 9: 106,102,086 (GRCm39) L459Q probably benign Het
Tmem104 C A 11: 115,091,654 (GRCm39) T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Zfp622 A T 15: 25,984,654 (GRCm39) I7F possibly damaging Het
Other mutations in Gtf3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Gtf3c2 APN 5 31,331,752 (GRCm39) missense probably damaging 1.00
IGL00832:Gtf3c2 APN 5 31,330,349 (GRCm39) unclassified probably benign
IGL00904:Gtf3c2 APN 5 31,330,202 (GRCm39) missense probably damaging 1.00
IGL00966:Gtf3c2 APN 5 31,327,517 (GRCm39) critical splice donor site probably benign 0.00
IGL01061:Gtf3c2 APN 5 31,325,698 (GRCm39) missense possibly damaging 0.94
IGL01148:Gtf3c2 APN 5 31,317,168 (GRCm39) missense probably damaging 1.00
IGL01767:Gtf3c2 APN 5 31,314,979 (GRCm39) missense probably benign 0.08
IGL02237:Gtf3c2 APN 5 31,316,397 (GRCm39) splice site probably benign
IGL02458:Gtf3c2 APN 5 31,316,867 (GRCm39) critical splice acceptor site probably null
IGL02888:Gtf3c2 APN 5 31,331,169 (GRCm39) missense probably damaging 1.00
IGL03035:Gtf3c2 APN 5 31,323,358 (GRCm39) missense possibly damaging 0.96
IGL03131:Gtf3c2 APN 5 31,314,964 (GRCm39) missense probably damaging 0.98
R0581:Gtf3c2 UTSW 5 31,316,862 (GRCm39) nonsense probably null
R0634:Gtf3c2 UTSW 5 31,317,150 (GRCm39) nonsense probably null
R1172:Gtf3c2 UTSW 5 31,325,419 (GRCm39) missense probably damaging 1.00
R1511:Gtf3c2 UTSW 5 31,316,446 (GRCm39) missense probably benign 0.15
R1680:Gtf3c2 UTSW 5 31,331,212 (GRCm39) missense probably damaging 1.00
R1726:Gtf3c2 UTSW 5 31,326,467 (GRCm39) missense possibly damaging 0.82
R1831:Gtf3c2 UTSW 5 31,325,713 (GRCm39) missense probably damaging 1.00
R2006:Gtf3c2 UTSW 5 31,325,440 (GRCm39) missense probably damaging 0.99
R2437:Gtf3c2 UTSW 5 31,317,042 (GRCm39) critical splice donor site probably null
R4732:Gtf3c2 UTSW 5 31,317,401 (GRCm39) missense probably damaging 0.97
R4733:Gtf3c2 UTSW 5 31,317,401 (GRCm39) missense probably damaging 0.97
R4787:Gtf3c2 UTSW 5 31,314,921 (GRCm39) missense probably benign 0.03
R4817:Gtf3c2 UTSW 5 31,331,434 (GRCm39) critical splice acceptor site probably null
R4863:Gtf3c2 UTSW 5 31,316,577 (GRCm39) intron probably benign
R4926:Gtf3c2 UTSW 5 31,326,467 (GRCm39) missense possibly damaging 0.82
R5508:Gtf3c2 UTSW 5 31,331,805 (GRCm39) nonsense probably null
R5704:Gtf3c2 UTSW 5 31,316,454 (GRCm39) missense probably damaging 1.00
R5737:Gtf3c2 UTSW 5 31,325,593 (GRCm39) critical splice donor site probably null
R5868:Gtf3c2 UTSW 5 31,325,425 (GRCm39) missense possibly damaging 0.94
R6174:Gtf3c2 UTSW 5 31,315,555 (GRCm39) missense probably damaging 1.00
R6705:Gtf3c2 UTSW 5 31,323,352 (GRCm39) missense possibly damaging 0.93
R6782:Gtf3c2 UTSW 5 31,327,180 (GRCm39) missense probably benign 0.01
R6893:Gtf3c2 UTSW 5 31,323,722 (GRCm39) missense probably benign 0.06
R7363:Gtf3c2 UTSW 5 31,327,600 (GRCm39) missense probably damaging 1.00
R7474:Gtf3c2 UTSW 5 31,325,100 (GRCm39) missense probably damaging 1.00
R7578:Gtf3c2 UTSW 5 31,330,341 (GRCm39) missense probably benign
R7685:Gtf3c2 UTSW 5 31,325,611 (GRCm39) missense probably damaging 1.00
R7711:Gtf3c2 UTSW 5 31,327,533 (GRCm39) missense probably damaging 1.00
R7754:Gtf3c2 UTSW 5 31,330,175 (GRCm39) missense probably benign 0.38
R7825:Gtf3c2 UTSW 5 31,315,715 (GRCm39) missense probably damaging 0.99
R7994:Gtf3c2 UTSW 5 31,327,217 (GRCm39) missense possibly damaging 0.60
R8430:Gtf3c2 UTSW 5 31,330,403 (GRCm39) missense probably damaging 1.00
R8772:Gtf3c2 UTSW 5 31,331,758 (GRCm39) missense probably benign 0.26
R8950:Gtf3c2 UTSW 5 31,331,151 (GRCm39) missense probably damaging 1.00
R9221:Gtf3c2 UTSW 5 31,326,401 (GRCm39) missense probably damaging 1.00
R9451:Gtf3c2 UTSW 5 31,325,773 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCAGCCATCCATAGGAGTCCAG -3'
(R):5'- GATTTGATACCATACCAGGACAGCCC -3'

Sequencing Primer
(F):5'- cacacctttcatctcagcaatc -3'
(R):5'- CACTACTTGCTCTTTCAAGATACAG -3'
Posted On 2013-06-12