Mutagenetix > Incidental Mutations

Incidental Mutation 'R0534:Gpr37'

49361

Institutional Source

Beutler Lab

Gene Symbol

Gpr37

Ensembl Gene

ENSMUSG00000039904

Gene Name

G protein-coupled receptor 37

Synonyms

parkin-associated endothelin B-like receptor, Pael-R

MMRRC Submission

038726-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R0534 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25665878-25690729 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 25669824 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 340 (C340*)

Ref Sequence

ENSEMBL: ENSMUSP00000144683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054867] [ENSMUST00000200812]

Predicted Effect

probably null
Transcript: ENSMUST00000054867
AA Change: C340*

SMART Domains

Protein: ENSMUSP00000052185
Gene: ENSMUSG00000039904
AA Change: C340*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	101	116	N/A	INTRINSIC
Pfam:7tm_1	265	536	5.2e-33	PFAM
low complexity region	549	558	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000200812
AA Change: C340*

SMART Domains

Protein: ENSMUSP00000144683
Gene: ENSMUSG00000039904
AA Change: C340*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	101	116	N/A	INTRINSIC
Pfam:7tm_1	265	421	3.4e-26	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G protein-coupled receptor family. The encoded protein contains seven transmembrane domains and is found in cell and endoplasmic reticulum membranes. G protein-coupled receptors are involved in translating outside signals into G protein mediated intracellular effects. This gene product interacts with Parkin and is involved in juvenile Parkinson disease. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit reduced striatal dopamine content, enhanced amphetamine sensitivity, reduced motor activity and coordination and increased percentage of body fat in females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	T	C	10: 116,112,802	E273G	possibly damaging	Het
4933425L06Rik	C	A	13: 105,082,254	S32*	probably null	Het
Cand2	A	G	6: 115,787,236	M324V	probably damaging	Het
Cap1	C	T	4: 122,862,719	V340M	probably benign	Het
Ccdc110	T	C	8: 45,935,138	V44A	possibly damaging	Het
Cps1	A	G	1: 67,143,900	D139G	probably benign	Het
Cwc27	T	A	13: 104,631,616	E457V	unknown	Het
Cxxc1	C	T	18: 74,218,891	P280S	probably benign	Het
Dopey2	T	A	16: 93,762,505	L595Q	probably benign	Het
Dscam	G	T	16: 96,652,172	S1292R	possibly damaging	Het
E2f4	C	A	8: 105,304,219	F353L	probably damaging	Het
Ep300	A	G	15: 81,600,896		probably benign	Het
Fads1	C	T	19: 10,183,065	P5L	probably benign	Het
Fign	T	A	2: 63,980,791	H45L	probably damaging	Het
Flcn	T	A	11: 59,794,199		probably benign	Het
Gm5141	A	T	13: 62,774,594	F254I	probably damaging	Het
Gpbp1l1	T	A	4: 116,591,268	N402K	probably damaging	Het
Gtf3c2	A	T	5: 31,158,132		probably benign	Het
Hcfc2	T	A	10: 82,738,408	F139I	probably damaging	Het
Hectd4	T	C	5: 121,348,476	L3178P	possibly damaging	Het
Hrc	AGAGGAGGAGGAAGAGGAGGAGGA	AGAGGAGGAGGAGGAAGAGGAGGAGGA	7: 45,337,235		probably benign	Het
Igf2bp1	A	G	11: 95,966,796		probably benign	Het
Igsf9b	T	G	9: 27,333,062		probably null	Het
Il23r	G	A	6: 67,426,588	A443V	probably benign	Het
Kcnv1	A	G	15: 45,109,249	F413L	probably damaging	Het
Lipe	C	A	7: 25,388,186	A150S	possibly damaging	Het
Lrrcc1	T	C	3: 14,557,273	S557P	probably damaging	Het
Mrpl54	C	A	10: 81,266,853	W13L	probably damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Npy1r	C	A	8: 66,705,018	Q327K	probably damaging	Het
Olfr64	C	T	7: 103,893,231	R168H	probably benign	Het
Osbpl10	C	T	9: 115,167,178	L139F	probably damaging	Het
P2rx6	A	C	16: 17,567,904	T199P	probably damaging	Het
Phyhip	A	T	14: 70,461,759	M1L	possibly damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Psmc1	T	A	12: 100,120,130	I342N	possibly damaging	Het
Reln	A	T	5: 21,947,408	D2353E	probably damaging	Het
Rmdn3	T	C	2: 119,146,370	E294G	probably benign	Het
Scnn1g	A	G	7: 121,767,424	M615V	probably benign	Het
Shcbp1l	T	A	1: 153,428,568	D124E	possibly damaging	Het
Sipa1l1	T	C	12: 82,425,280	S1345P	possibly damaging	Het
Soga3	T	A	10: 29,180,956		probably benign	Het
St5	A	T	7: 109,541,428	V197D	probably damaging	Het
Timp4	A	G	6: 115,249,841	Y114H	probably damaging	Het
Tlr9	T	A	9: 106,224,887	L459Q	probably benign	Het
Tmem104	C	A	11: 115,200,828	T59K	probably damaging	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Zfp622	A	T	15: 25,984,568	I7F	possibly damaging	Het

Other mutations in Gpr37

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00786:Gpr37	APN	6	25669318	missense	possibly damaging	0.65
IGL01595:Gpr37	APN	6	25669573	missense	probably damaging	1.00
IGL01670:Gpr37	APN	6	25669834	missense	probably damaging	1.00
IGL02552:Gpr37	APN	6	25688687	missense	probably benign	0.05
IGL03331:Gpr37	APN	6	25669729	missense	probably benign	0.26
R0375:Gpr37	UTSW	6	25669291	missense	probably benign	0.08
R0892:Gpr37	UTSW	6	25688207	missense	probably damaging	1.00
R1481:Gpr37	UTSW	6	25669138	missense	probably damaging	0.99
R1700:Gpr37	UTSW	6	25669624	missense	probably benign	0.09
R2083:Gpr37	UTSW	6	25688417	missense	possibly damaging	0.62
R2089:Gpr37	UTSW	6	25689063	missense	possibly damaging	0.73
R2091:Gpr37	UTSW	6	25689063	missense	possibly damaging	0.73
R2091:Gpr37	UTSW	6	25689063	missense	possibly damaging	0.73
R2112:Gpr37	UTSW	6	25669381	missense	possibly damaging	0.91
R2847:Gpr37	UTSW	6	25666946	unclassified	probably benign
R2848:Gpr37	UTSW	6	25666946	unclassified	probably benign
R4119:Gpr37	UTSW	6	25688426	missense	possibly damaging	0.90
R4611:Gpr37	UTSW	6	25669624	missense	probably benign	0.09
R4734:Gpr37	UTSW	6	25689086	missense	possibly damaging	0.53
R4765:Gpr37	UTSW	6	25669108	missense	probably damaging	1.00
R5163:Gpr37	UTSW	6	25669615	missense	possibly damaging	0.87
R5669:Gpr37	UTSW	6	25669352	missense	probably benign	0.05
R6548:Gpr37	UTSW	6	25688813	missense	probably benign	0.32
R6760:Gpr37	UTSW	6	25669169	missense	probably benign	0.00
R7030:Gpr37	UTSW	6	25689005	missense	possibly damaging	0.92
R7278:Gpr37	UTSW	6	25669342	missense	possibly damaging	0.68
R7392:Gpr37	UTSW	6	25688787	missense	probably benign	0.34
R7726:Gpr37	UTSW	6	25669117	missense	possibly damaging	0.94
R7754:Gpr37	UTSW	6	25689050	missense	probably damaging	0.99
R7757:Gpr37	UTSW	6	25688208	missense	probably benign	0.26
V7732:Gpr37	UTSW	6	25669123	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCCTTGCACCATCATAGGTGAGAG -3'
(R):5'- AAAGTCACACAGGACTTGCTGACC -3'

Sequencing Primer
(F):5'- GCCAAAACATAGATTGTGTCCG -3'
(R):5'- ttcccctgctttctgctc -3'

Posted On

2013-06-12