Mutagenetix > Incidental Mutation

Incidental Mutation 'R0534:Cand2'

49364

Institutional Source

Beutler Lab

Gene Symbol

Cand2

Ensembl Gene

ENSMUSG00000030319

Gene Name

cullin-associated and neddylation-dissociated 2 (putative)

Synonyms

2210404G23Rik, Tp120b

MMRRC Submission

038726-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0534 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115774538-115805557 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115787236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 324 (M324V)

Ref Sequence

ENSEMBL: ENSMUSP00000075377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075995]

AlphaFold

Q6ZQ73

Predicted Effect

probably damaging
Transcript: ENSMUST00000075995
AA Change: M324V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000075377
Gene: ENSMUSG00000030319
AA Change: M324V

Domain	Start	End	E-Value	Type
low complexity region	325	347	N/A	INTRINSIC
low complexity region	536	548	N/A	INTRINSIC
low complexity region	553	562	N/A	INTRINSIC
low complexity region	665	686	N/A	INTRINSIC
low complexity region	736	748	N/A	INTRINSIC
Pfam:HEAT	861	890	4.4e-5	PFAM
Pfam:TIP120	1044	1209	6e-64	PFAM

Meta Mutation Damage Score

0.1161

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

96% (47/49)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	T	C	10: 116,112,802	E273G	possibly damaging	Het
4933425L06Rik	C	A	13: 105,082,254	S32*	probably null	Het
Cap1	C	T	4: 122,862,719	V340M	probably benign	Het
Ccdc110	T	C	8: 45,935,138	V44A	possibly damaging	Het
Cps1	A	G	1: 67,143,900	D139G	probably benign	Het
Cwc27	T	A	13: 104,631,616	E457V	unknown	Het
Cxxc1	C	T	18: 74,218,891	P280S	probably benign	Het
Dopey2	T	A	16: 93,762,505	L595Q	probably benign	Het
Dscam	G	T	16: 96,652,172	S1292R	possibly damaging	Het
E2f4	C	A	8: 105,304,219	F353L	probably damaging	Het
Ep300	A	G	15: 81,600,896		probably benign	Het
Fads1	C	T	19: 10,183,065	P5L	probably benign	Het
Fign	T	A	2: 63,980,791	H45L	probably damaging	Het
Flcn	T	A	11: 59,794,199		probably benign	Het
Gm5141	A	T	13: 62,774,594	F254I	probably damaging	Het
Gpbp1l1	T	A	4: 116,591,268	N402K	probably damaging	Het
Gpr37	A	T	6: 25,669,824	C340*	probably null	Het
Gtf3c2	A	T	5: 31,158,132		probably benign	Het
Hcfc2	T	A	10: 82,738,408	F139I	probably damaging	Het
Hectd4	T	C	5: 121,348,476	L3178P	possibly damaging	Het
Hrc	AGAGGAGGAGGAAGAGGAGGAGGA	AGAGGAGGAGGAGGAAGAGGAGGAGGA	7: 45,337,235		probably benign	Het
Igf2bp1	A	G	11: 95,966,796		probably benign	Het
Igsf9b	T	G	9: 27,333,062		probably null	Het
Il23r	G	A	6: 67,426,588	A443V	probably benign	Het
Kcnv1	A	G	15: 45,109,249	F413L	probably damaging	Het
Lipe	C	A	7: 25,388,186	A150S	possibly damaging	Het
Lrrcc1	T	C	3: 14,557,273	S557P	probably damaging	Het
Mrpl54	C	A	10: 81,266,853	W13L	probably damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Npy1r	C	A	8: 66,705,018	Q327K	probably damaging	Het
Olfr64	C	T	7: 103,893,231	R168H	probably benign	Het
Osbpl10	C	T	9: 115,167,178	L139F	probably damaging	Het
P2rx6	A	C	16: 17,567,904	T199P	probably damaging	Het
Phyhip	A	T	14: 70,461,759	M1L	possibly damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Psmc1	T	A	12: 100,120,130	I342N	possibly damaging	Het
Reln	A	T	5: 21,947,408	D2353E	probably damaging	Het
Rmdn3	T	C	2: 119,146,370	E294G	probably benign	Het
Scnn1g	A	G	7: 121,767,424	M615V	probably benign	Het
Shcbp1l	T	A	1: 153,428,568	D124E	possibly damaging	Het
Sipa1l1	T	C	12: 82,425,280	S1345P	possibly damaging	Het
Soga3	T	A	10: 29,180,956		probably benign	Het
St5	A	T	7: 109,541,428	V197D	probably damaging	Het
Timp4	A	G	6: 115,249,841	Y114H	probably damaging	Het
Tlr9	T	A	9: 106,224,887	L459Q	probably benign	Het
Tmem104	C	A	11: 115,200,828	T59K	probably damaging	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Zfp622	A	T	15: 25,984,568	I7F	possibly damaging	Het

Other mutations in Cand2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01323:Cand2	APN	6	115785125	missense	probably benign
IGL01329:Cand2	APN	6	115782794	missense	probably benign	0.43
IGL01777:Cand2	APN	6	115792857	missense	probably damaging	0.99
IGL02008:Cand2	APN	6	115803638	missense	probably damaging	1.00
IGL02185:Cand2	APN	6	115789510	missense	probably benign	0.01
IGL02219:Cand2	APN	6	115803812	missense	probably damaging	1.00
IGL02240:Cand2	APN	6	115803662	missense	probably damaging	1.00
IGL02329:Cand2	APN	6	115789607	missense	probably damaging	1.00
IGL02396:Cand2	APN	6	115791188	splice site	probably benign
IGL02893:Cand2	APN	6	115791960	missense	probably damaging	1.00
IGL03161:Cand2	APN	6	115792737	missense	probably benign	0.45
IGL03170:Cand2	APN	6	115797900	missense	probably damaging	1.00
IGL03257:Cand2	APN	6	115799983	missense	possibly damaging	0.80
succor	UTSW	6	115791192	missense	probably damaging	1.00
R0196:Cand2	UTSW	6	115789502	missense	probably damaging	1.00
R0390:Cand2	UTSW	6	115774653	missense	possibly damaging	0.90
R0630:Cand2	UTSW	6	115803805	missense	probably damaging	1.00
R0631:Cand2	UTSW	6	115803805	missense	probably damaging	1.00
R0662:Cand2	UTSW	6	115787210	missense	probably benign	0.00
R0671:Cand2	UTSW	6	115803805	missense	probably damaging	1.00
R0708:Cand2	UTSW	6	115803805	missense	probably damaging	1.00
R0849:Cand2	UTSW	6	115792391	missense	probably damaging	1.00
R1992:Cand2	UTSW	6	115785132	missense	possibly damaging	0.88
R3428:Cand2	UTSW	6	115789707	missense	probably benign
R3773:Cand2	UTSW	6	115785217	missense	probably damaging	0.96
R4329:Cand2	UTSW	6	115799988	missense	possibly damaging	0.64
R4489:Cand2	UTSW	6	115789466	missense	probably damaging	1.00
R4553:Cand2	UTSW	6	115792211	missense	probably damaging	1.00
R4577:Cand2	UTSW	6	115791259	missense	probably damaging	1.00
R4634:Cand2	UTSW	6	115797987	missense	probably damaging	1.00
R4850:Cand2	UTSW	6	115801948	missense	probably benign	0.14
R5155:Cand2	UTSW	6	115792258	missense	probably benign	0.42
R5190:Cand2	UTSW	6	115789513	missense	probably damaging	1.00
R5378:Cand2	UTSW	6	115801951	missense	probably benign	0.00
R5407:Cand2	UTSW	6	115785200	missense	possibly damaging	0.76
R5698:Cand2	UTSW	6	115791743	missense	probably damaging	1.00
R5701:Cand2	UTSW	6	115797932	missense	probably damaging	0.99
R6172:Cand2	UTSW	6	115791310	missense	probably benign	0.00
R6763:Cand2	UTSW	6	115799969	missense	probably benign	0.00
R6920:Cand2	UTSW	6	115791289	missense	possibly damaging	0.93
R7229:Cand2	UTSW	6	115791192	missense	probably damaging	1.00
R7520:Cand2	UTSW	6	115785251	nonsense	probably null
R8183:Cand2	UTSW	6	115791918	missense	probably benign	0.14
R8698:Cand2	UTSW	6	115786891	missense	probably damaging	1.00
R8755:Cand2	UTSW	6	115792980	missense	probably damaging	1.00
R8795:Cand2	UTSW	6	115786928	missense	probably benign	0.01
R8900:Cand2	UTSW	6	115780933	missense	probably benign	0.00
R9072:Cand2	UTSW	6	115792529	missense	probably damaging	0.99
R9242:Cand2	UTSW	6	115791962	missense	probably benign	0.27
R9262:Cand2	UTSW	6	115782769	missense	probably benign	0.27
R9547:Cand2	UTSW	6	115782796	missense	probably benign	0.00
R9676:Cand2	UTSW	6	115792161	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- ATGAGCTAAGAGAGTCCTGCCTCC -3'
(R):5'- ATGACTGCACTGCCTTCCCTACAG -3'

Sequencing Primer
(F):5'- CCTTCCTAAGAAAGTAAGTGTGGC -3'
(R):5'- TTCCCTACAGCTAGAGAAGAGC -3'

Posted On

2013-06-12