Incidental Mutation 'R0534:Lipe'
ID 49365
Institutional Source Beutler Lab
Gene Symbol Lipe
Ensembl Gene ENSMUSG00000003123
Gene Name lipase, hormone sensitive
Synonyms HSL, 4933403G17Rik
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0534 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 25078952-25097911 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 25087611 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 150 (A150S)
Ref Sequence ENSEMBL: ENSMUSP00000145665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003207] [ENSMUST00000054301] [ENSMUST00000149349] [ENSMUST00000205698] [ENSMUST00000206861] [ENSMUST00000205923]
AlphaFold P54310
Predicted Effect probably benign
Transcript: ENSMUST00000003207
AA Change: A193S

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000003207
Gene: ENSMUSG00000003123
AA Change: A193S

DomainStartEndE-ValueType
Pfam:HSL_N 44 358 4.6e-148 PFAM
Pfam:DUF2424 345 504 1.1e-8 PFAM
Pfam:Abhydrolase_3 388 548 3e-36 PFAM
low complexity region 611 626 N/A INTRINSIC
Pfam:Abhydrolase_3 684 771 6.4e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000054301
AA Change: A150S

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050935
Gene: ENSMUSG00000003123
AA Change: A150S

DomainStartEndE-ValueType
Pfam:HSL_N 1 315 1.4e-148 PFAM
Pfam:DUF2424 302 461 1.5e-8 PFAM
Pfam:Abhydrolase_3 345 505 5.2e-36 PFAM
low complexity region 568 583 N/A INTRINSIC
Pfam:Abhydrolase_3 641 728 1.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066316
Predicted Effect probably benign
Transcript: ENSMUST00000149349
AA Change: A463S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123485
Gene: ENSMUSG00000003123
AA Change: A463S

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Pfam:HSL_N 319 627 1.2e-116 PFAM
Pfam:DUF2424 616 774 1.2e-8 PFAM
Pfam:Abhydrolase_3 658 817 1.9e-34 PFAM
low complexity region 881 896 N/A INTRINSIC
Pfam:Abhydrolase_3 951 1041 2.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205787
Predicted Effect possibly damaging
Transcript: ENSMUST00000206861
AA Change: A150S

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000205923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206588
Meta Mutation Damage Score 0.2946 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has a long and a short form, generated by use of alternative translational start codons. The long form is expressed in steroidogenic tissues such as testis, where it converts cholesteryl esters to free cholesterol for steroid hormone production. The short form is expressed in adipose tissue, among others, where it hydrolyzes stored triglycerides to free fatty acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations of this locus result in abnormal lipid homeostasis and, in some lines, defects in spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Targeted, other(5) Gene trapped(2)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cand2 A G 6: 115,764,197 (GRCm39) M324V probably damaging Het
Cap1 C T 4: 122,756,512 (GRCm39) V340M probably benign Het
Ccdc110 T C 8: 46,388,175 (GRCm39) V44A possibly damaging Het
Cps1 A G 1: 67,183,059 (GRCm39) D139G probably benign Het
Cwc27 T A 13: 104,768,124 (GRCm39) E457V unknown Het
Cxxc1 C T 18: 74,351,962 (GRCm39) P280S probably benign Het
Dennd2b A T 7: 109,140,635 (GRCm39) V197D probably damaging Het
Dop1b T A 16: 93,559,393 (GRCm39) L595Q probably benign Het
Dscam G T 16: 96,453,372 (GRCm39) S1292R possibly damaging Het
E2f4 C A 8: 106,030,851 (GRCm39) F353L probably damaging Het
Ep300 A G 15: 81,485,097 (GRCm39) probably benign Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
Fign T A 2: 63,811,135 (GRCm39) H45L probably damaging Het
Flcn T A 11: 59,685,025 (GRCm39) probably benign Het
Gm5141 A T 13: 62,922,408 (GRCm39) F254I probably damaging Het
Gpbp1l1 T A 4: 116,448,465 (GRCm39) N402K probably damaging Het
Gpr37 A T 6: 25,669,823 (GRCm39) C340* probably null Het
Gtf3c2 A T 5: 31,315,476 (GRCm39) probably benign Het
Hcfc2 T A 10: 82,574,242 (GRCm39) F139I probably damaging Het
Hectd4 T C 5: 121,486,539 (GRCm39) L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 44,986,659 (GRCm39) probably benign Het
Igf2bp1 A G 11: 95,857,622 (GRCm39) probably benign Het
Igsf9b T G 9: 27,244,358 (GRCm39) probably null Het
Il23r G A 6: 67,403,572 (GRCm39) A443V probably benign Het
Kcnv1 A G 15: 44,972,645 (GRCm39) F413L probably damaging Het
Lrrcc1 T C 3: 14,622,333 (GRCm39) S557P probably damaging Het
Mrpl54 C A 10: 81,102,687 (GRCm39) W13L probably damaging Het
Mtcl3 T A 10: 29,056,952 (GRCm39) probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Npy1r C A 8: 67,157,670 (GRCm39) Q327K probably damaging Het
Nt5el C A 13: 105,218,762 (GRCm39) S32* probably null Het
Or51b17 C T 7: 103,542,438 (GRCm39) R168H probably benign Het
Osbpl10 C T 9: 114,996,246 (GRCm39) L139F probably damaging Het
P2rx6 A C 16: 17,385,768 (GRCm39) T199P probably damaging Het
Phyhip A T 14: 70,699,199 (GRCm39) M1L possibly damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Psmc1 T A 12: 100,086,389 (GRCm39) I342N possibly damaging Het
Reln A T 5: 22,152,406 (GRCm39) D2353E probably damaging Het
Rmdn3 T C 2: 118,976,851 (GRCm39) E294G probably benign Het
Scnn1g A G 7: 121,366,647 (GRCm39) M615V probably benign Het
Shcbp1l T A 1: 153,304,314 (GRCm39) D124E possibly damaging Het
Sipa1l1 T C 12: 82,472,054 (GRCm39) S1345P possibly damaging Het
Taf7l2 T C 10: 115,948,707 (GRCm39) E273G possibly damaging Het
Timp4 A G 6: 115,226,802 (GRCm39) Y114H probably damaging Het
Tlr9 T A 9: 106,102,086 (GRCm39) L459Q probably benign Het
Tmem104 C A 11: 115,091,654 (GRCm39) T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Zfp622 A T 15: 25,984,654 (GRCm39) I7F possibly damaging Het
Other mutations in Lipe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lipe APN 7 25,082,977 (GRCm39) missense probably damaging 1.00
IGL00517:Lipe APN 7 25,087,985 (GRCm39) splice site probably null
IGL00817:Lipe APN 7 25,087,874 (GRCm39) missense probably damaging 1.00
IGL01459:Lipe APN 7 25,082,967 (GRCm39) missense probably damaging 1.00
IGL01946:Lipe APN 7 25,082,701 (GRCm39) missense possibly damaging 0.90
IGL02931:Lipe APN 7 25,082,760 (GRCm39) splice site probably benign
IGL02973:Lipe APN 7 25,083,057 (GRCm39) missense probably damaging 0.98
IGL03091:Lipe APN 7 25,080,180 (GRCm39) missense probably damaging 1.00
fett UTSW 7 25,088,007 (GRCm39) missense probably benign
grassa UTSW 7 25,084,750 (GRCm39) missense probably damaging 0.99
reservoir UTSW 7 25,079,568 (GRCm39) missense probably damaging 1.00
3-1:Lipe UTSW 7 25,097,245 (GRCm39) missense probably damaging 0.97
PIT4243001:Lipe UTSW 7 25,094,971 (GRCm39) missense probably benign
R0062:Lipe UTSW 7 25,097,874 (GRCm39) missense possibly damaging 0.46
R0062:Lipe UTSW 7 25,097,874 (GRCm39) missense possibly damaging 0.46
R0432:Lipe UTSW 7 25,097,913 (GRCm39) missense probably benign 0.00
R0528:Lipe UTSW 7 25,097,901 (GRCm39) missense possibly damaging 0.92
R1487:Lipe UTSW 7 25,084,240 (GRCm39) missense possibly damaging 0.47
R1502:Lipe UTSW 7 25,097,572 (GRCm39) missense possibly damaging 0.66
R1606:Lipe UTSW 7 25,087,569 (GRCm39) missense probably damaging 1.00
R1713:Lipe UTSW 7 25,084,750 (GRCm39) missense probably damaging 0.99
R2147:Lipe UTSW 7 25,087,946 (GRCm39) missense probably benign 0.01
R3031:Lipe UTSW 7 25,084,320 (GRCm39) missense possibly damaging 0.65
R3110:Lipe UTSW 7 25,097,848 (GRCm39) missense probably benign
R3112:Lipe UTSW 7 25,097,848 (GRCm39) missense probably benign
R3792:Lipe UTSW 7 25,097,045 (GRCm39) missense possibly damaging 0.82
R4453:Lipe UTSW 7 25,097,115 (GRCm39) missense probably damaging 0.99
R4582:Lipe UTSW 7 25,097,127 (GRCm39) missense probably benign
R4816:Lipe UTSW 7 25,079,568 (GRCm39) missense probably damaging 1.00
R5639:Lipe UTSW 7 25,082,750 (GRCm39) missense probably benign 0.00
R5653:Lipe UTSW 7 25,097,833 (GRCm39) missense probably benign 0.08
R6322:Lipe UTSW 7 25,079,961 (GRCm39) missense probably damaging 1.00
R6575:Lipe UTSW 7 25,082,749 (GRCm39) missense probably benign 0.03
R7065:Lipe UTSW 7 25,084,603 (GRCm39) critical splice donor site probably null
R7250:Lipe UTSW 7 25,088,085 (GRCm39) start gained probably benign
R7485:Lipe UTSW 7 25,080,036 (GRCm39) missense probably benign 0.01
R7636:Lipe UTSW 7 25,088,042 (GRCm39) missense probably benign 0.42
R8447:Lipe UTSW 7 25,080,017 (GRCm39) missense probably damaging 1.00
R8754:Lipe UTSW 7 25,088,007 (GRCm39) missense probably benign
R9025:Lipe UTSW 7 25,083,923 (GRCm39) missense probably damaging 0.99
R9399:Lipe UTSW 7 25,097,227 (GRCm39) missense probably benign 0.35
R9594:Lipe UTSW 7 25,098,128 (GRCm39) unclassified probably benign
R9615:Lipe UTSW 7 25,097,326 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTAGTTACGAGCCATGAGTCTGTGC -3'
(R):5'- AAAGTATCTTCTTCCGTGCCAGCC -3'

Sequencing Primer
(F):5'- AGAGCCCAGTTCTGAGTTCC -3'
(R):5'- CACAACCTAGCAGAGCTGGAG -3'
Posted On 2013-06-12