Incidental Mutation 'R0534:Olfr64'
ID49366
Institutional Source Beutler Lab
Gene Symbol Olfr64
Ensembl Gene ENSMUSG00000063615
Gene Nameolfactory receptor 64
SynonymsGA_x6K02T2PBJ9-6648196-6649143, 5'[b]2, MOR1-2
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R0534 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103889485-103894485 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103893231 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 168 (R168H)
Ref Sequence ENSEMBL: ENSMUSP00000080444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081748]
Predicted Effect probably benign
Transcript: ENSMUST00000081748
AA Change: R168H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080444
Gene: ENSMUSG00000063615
AA Change: R168H

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.4e-113 PFAM
Pfam:7TM_GPCR_Srsx 33 295 4.2e-6 PFAM
Pfam:7tm_1 39 290 1.1e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Olfr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Olfr64 APN 7 103892864 nonsense probably null
IGL01597:Olfr64 APN 7 103893096 missense probably benign 0.01
IGL01868:Olfr64 APN 7 103893376 nonsense probably null
IGL02502:Olfr64 APN 7 103893489 missense probably damaging 0.99
R0294:Olfr64 UTSW 7 103892930 missense probably benign 0.09
R0838:Olfr64 UTSW 7 103893415 missense probably benign 0.00
R1350:Olfr64 UTSW 7 103893730 missense probably benign 0.01
R1733:Olfr64 UTSW 7 103892911 missense probably benign 0.40
R1768:Olfr64 UTSW 7 103893277 missense probably benign 0.28
R1780:Olfr64 UTSW 7 103893555 missense probably damaging 1.00
R1836:Olfr64 UTSW 7 103893385 missense probably damaging 0.98
R1956:Olfr64 UTSW 7 103893718 missense probably benign 0.01
R2075:Olfr64 UTSW 7 103892920 missense probably damaging 0.96
R4677:Olfr64 UTSW 7 103893408 missense probably damaging 1.00
R4884:Olfr64 UTSW 7 103893655 missense probably benign 0.04
R4899:Olfr64 UTSW 7 103893465 missense possibly damaging 0.54
R5753:Olfr64 UTSW 7 103893201 missense probably damaging 1.00
R6351:Olfr64 UTSW 7 103893135 nonsense probably null
R6997:Olfr64 UTSW 7 103893031 missense probably benign 0.00
R8319:Olfr64 UTSW 7 103893429 missense probably damaging 1.00
R8337:Olfr64 UTSW 7 103893049 missense probably benign
X0017:Olfr64 UTSW 7 103893151 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGGAGAACGCTCCTCTGAATTTGC -3'
(R):5'- CCCTTTCCATTGTGGAGTCAGGTG -3'

Sequencing Primer
(F):5'- TGTCAGGCCAATCACAGTG -3'
(R):5'- AGTCAGGTGTCTTGCTTGCC -3'
Posted On2013-06-12