Incidental Mutation 'R0534:Scnn1g'
ID49368
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Namesodium channel, nonvoltage-gated 1 gamma
SynonymsENaC gamma
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R0534 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location121734479-121768475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121767424 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 615 (M615V)
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
Predicted Effect probably benign
Transcript: ENSMUST00000000221
AA Change: M615V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: M615V

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121740437 missense probably benign 0.00
IGL01824:Scnn1g APN 7 121766293 missense probably benign 0.00
IGL02133:Scnn1g APN 7 121743699 missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121742446 splice site probably benign
IGL02814:Scnn1g APN 7 121740365 missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121746683 missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121737933 nonsense probably null
PIT4504001:Scnn1g UTSW 7 121742331 missense probably benign 0.30
R0230:Scnn1g UTSW 7 121746761 splice site probably benign
R0324:Scnn1g UTSW 7 121740555 missense possibly damaging 0.62
R0367:Scnn1g UTSW 7 121746579 splice site probably benign
R1747:Scnn1g UTSW 7 121760463 missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121738188 nonsense probably null
R2197:Scnn1g UTSW 7 121767296 missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121740427 missense probably benign 0.01
R4804:Scnn1g UTSW 7 121763080 frame shift probably null
R4805:Scnn1g UTSW 7 121746602 missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121766266 missense probably damaging 1.00
R5757:Scnn1g UTSW 7 121738215 missense probably damaging 1.00
R5882:Scnn1g UTSW 7 121767358 missense possibly damaging 0.79
R5910:Scnn1g UTSW 7 121738095 missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121767499 missense probably benign 0.00
R6666:Scnn1g UTSW 7 121767388 missense probably benign 0.00
R6735:Scnn1g UTSW 7 121742263 missense probably benign 0.02
R6813:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121740353 missense probably damaging 1.00
R6887:Scnn1g UTSW 7 121760444 missense probably benign 0.01
R7289:Scnn1g UTSW 7 121738081 nonsense probably null
R7488:Scnn1g UTSW 7 121763434 missense probably benign 0.00
R7630:Scnn1g UTSW 7 121760481 missense probably damaging 1.00
R7888:Scnn1g UTSW 7 121743655 missense probably damaging 0.97
R7917:Scnn1g UTSW 7 121743693 missense probably damaging 1.00
Z1177:Scnn1g UTSW 7 121760475 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCCCTTGCAGATTGAGATGCTCC -3'
(R):5'- CCTGTTCACAGCAGGCTGTTAGAC -3'

Sequencing Primer
(F):5'- CAGATTGAGATGCTCCTGTCTAAC -3'
(R):5'- CAGCAGGCTGTTAGACATGTATC -3'
Posted On2013-06-12