Incidental Mutation 'R0534:Scnn1g'
ID 49368
Institutional Source Beutler Lab
Gene Symbol Scnn1g
Ensembl Gene ENSMUSG00000000216
Gene Name sodium channel, nonvoltage-gated 1 gamma
Synonyms ENaC gamma
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.591) question?
Stock # R0534 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 121333702-121367698 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 121366647 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 615 (M615V)
Ref Sequence ENSEMBL: ENSMUSP00000000221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000221]
AlphaFold Q9WU39
Predicted Effect probably benign
Transcript: ENSMUST00000000221
AA Change: M615V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: M615V

DomainStartEndE-ValueType
Pfam:ASC 32 558 6.4e-91 PFAM
low complexity region 618 631 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cand2 A G 6: 115,764,197 (GRCm39) M324V probably damaging Het
Cap1 C T 4: 122,756,512 (GRCm39) V340M probably benign Het
Ccdc110 T C 8: 46,388,175 (GRCm39) V44A possibly damaging Het
Cps1 A G 1: 67,183,059 (GRCm39) D139G probably benign Het
Cwc27 T A 13: 104,768,124 (GRCm39) E457V unknown Het
Cxxc1 C T 18: 74,351,962 (GRCm39) P280S probably benign Het
Dennd2b A T 7: 109,140,635 (GRCm39) V197D probably damaging Het
Dop1b T A 16: 93,559,393 (GRCm39) L595Q probably benign Het
Dscam G T 16: 96,453,372 (GRCm39) S1292R possibly damaging Het
E2f4 C A 8: 106,030,851 (GRCm39) F353L probably damaging Het
Ep300 A G 15: 81,485,097 (GRCm39) probably benign Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
Fign T A 2: 63,811,135 (GRCm39) H45L probably damaging Het
Flcn T A 11: 59,685,025 (GRCm39) probably benign Het
Gm5141 A T 13: 62,922,408 (GRCm39) F254I probably damaging Het
Gpbp1l1 T A 4: 116,448,465 (GRCm39) N402K probably damaging Het
Gpr37 A T 6: 25,669,823 (GRCm39) C340* probably null Het
Gtf3c2 A T 5: 31,315,476 (GRCm39) probably benign Het
Hcfc2 T A 10: 82,574,242 (GRCm39) F139I probably damaging Het
Hectd4 T C 5: 121,486,539 (GRCm39) L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 44,986,659 (GRCm39) probably benign Het
Igf2bp1 A G 11: 95,857,622 (GRCm39) probably benign Het
Igsf9b T G 9: 27,244,358 (GRCm39) probably null Het
Il23r G A 6: 67,403,572 (GRCm39) A443V probably benign Het
Kcnv1 A G 15: 44,972,645 (GRCm39) F413L probably damaging Het
Lipe C A 7: 25,087,611 (GRCm39) A150S possibly damaging Het
Lrrcc1 T C 3: 14,622,333 (GRCm39) S557P probably damaging Het
Mrpl54 C A 10: 81,102,687 (GRCm39) W13L probably damaging Het
Mtcl3 T A 10: 29,056,952 (GRCm39) probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Npy1r C A 8: 67,157,670 (GRCm39) Q327K probably damaging Het
Nt5el C A 13: 105,218,762 (GRCm39) S32* probably null Het
Or51b17 C T 7: 103,542,438 (GRCm39) R168H probably benign Het
Osbpl10 C T 9: 114,996,246 (GRCm39) L139F probably damaging Het
P2rx6 A C 16: 17,385,768 (GRCm39) T199P probably damaging Het
Phyhip A T 14: 70,699,199 (GRCm39) M1L possibly damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Psmc1 T A 12: 100,086,389 (GRCm39) I342N possibly damaging Het
Reln A T 5: 22,152,406 (GRCm39) D2353E probably damaging Het
Rmdn3 T C 2: 118,976,851 (GRCm39) E294G probably benign Het
Shcbp1l T A 1: 153,304,314 (GRCm39) D124E possibly damaging Het
Sipa1l1 T C 12: 82,472,054 (GRCm39) S1345P possibly damaging Het
Taf7l2 T C 10: 115,948,707 (GRCm39) E273G possibly damaging Het
Timp4 A G 6: 115,226,802 (GRCm39) Y114H probably damaging Het
Tlr9 T A 9: 106,102,086 (GRCm39) L459Q probably benign Het
Tmem104 C A 11: 115,091,654 (GRCm39) T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Zfp622 A T 15: 25,984,654 (GRCm39) I7F possibly damaging Het
Other mutations in Scnn1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Scnn1g APN 7 121,339,660 (GRCm39) missense probably benign 0.00
IGL01824:Scnn1g APN 7 121,365,516 (GRCm39) missense probably benign 0.00
IGL02133:Scnn1g APN 7 121,342,922 (GRCm39) missense probably damaging 1.00
IGL02529:Scnn1g APN 7 121,341,669 (GRCm39) splice site probably benign
IGL02814:Scnn1g APN 7 121,339,588 (GRCm39) missense probably damaging 1.00
IGL03091:Scnn1g APN 7 121,345,906 (GRCm39) missense probably damaging 1.00
IGL03253:Scnn1g APN 7 121,337,156 (GRCm39) nonsense probably null
PIT4504001:Scnn1g UTSW 7 121,341,554 (GRCm39) missense probably benign 0.30
R0230:Scnn1g UTSW 7 121,345,984 (GRCm39) splice site probably benign
R0324:Scnn1g UTSW 7 121,339,778 (GRCm39) missense possibly damaging 0.62
R0367:Scnn1g UTSW 7 121,345,802 (GRCm39) splice site probably benign
R1747:Scnn1g UTSW 7 121,359,686 (GRCm39) missense probably damaging 0.99
R2004:Scnn1g UTSW 7 121,337,411 (GRCm39) nonsense probably null
R2197:Scnn1g UTSW 7 121,366,519 (GRCm39) missense probably damaging 1.00
R4396:Scnn1g UTSW 7 121,339,650 (GRCm39) missense probably benign 0.01
R4804:Scnn1g UTSW 7 121,362,303 (GRCm39) frame shift probably null
R4805:Scnn1g UTSW 7 121,345,825 (GRCm39) missense probably damaging 1.00
R5219:Scnn1g UTSW 7 121,365,489 (GRCm39) missense probably damaging 1.00
R5757:Scnn1g UTSW 7 121,337,438 (GRCm39) missense probably damaging 1.00
R5882:Scnn1g UTSW 7 121,366,581 (GRCm39) missense possibly damaging 0.79
R5910:Scnn1g UTSW 7 121,337,318 (GRCm39) missense probably damaging 0.99
R6381:Scnn1g UTSW 7 121,366,722 (GRCm39) missense probably benign 0.00
R6666:Scnn1g UTSW 7 121,366,611 (GRCm39) missense probably benign 0.00
R6735:Scnn1g UTSW 7 121,341,486 (GRCm39) missense probably benign 0.02
R6813:Scnn1g UTSW 7 121,339,576 (GRCm39) missense probably damaging 1.00
R6860:Scnn1g UTSW 7 121,339,576 (GRCm39) missense probably damaging 1.00
R6887:Scnn1g UTSW 7 121,359,667 (GRCm39) missense probably benign 0.01
R7289:Scnn1g UTSW 7 121,337,304 (GRCm39) nonsense probably null
R7488:Scnn1g UTSW 7 121,362,657 (GRCm39) missense probably benign 0.00
R7630:Scnn1g UTSW 7 121,359,704 (GRCm39) missense probably damaging 1.00
R7888:Scnn1g UTSW 7 121,342,878 (GRCm39) missense probably damaging 0.97
R7917:Scnn1g UTSW 7 121,342,916 (GRCm39) missense probably damaging 1.00
R9051:Scnn1g UTSW 7 121,341,566 (GRCm39) missense possibly damaging 0.86
R9312:Scnn1g UTSW 7 121,339,818 (GRCm39) missense probably benign 0.00
Z1177:Scnn1g UTSW 7 121,359,698 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCCCTTGCAGATTGAGATGCTCC -3'
(R):5'- CCTGTTCACAGCAGGCTGTTAGAC -3'

Sequencing Primer
(F):5'- CAGATTGAGATGCTCCTGTCTAAC -3'
(R):5'- CAGCAGGCTGTTAGACATGTATC -3'
Posted On 2013-06-12