Incidental Mutation 'R0534:E2f4'
ID 49371
Institutional Source Beutler Lab
Gene Symbol E2f4
Ensembl Gene ENSMUSG00000014859
Gene Name E2F transcription factor 4
Synonyms 2010111M04Rik
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0534 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 106024295-106032002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 106030851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 353 (F353L)
Ref Sequence ENSEMBL: ENSMUSP00000015003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015003] [ENSMUST00000109375] [ENSMUST00000212033] [ENSMUST00000212046]
AlphaFold Q8R0K9
Predicted Effect probably damaging
Transcript: ENSMUST00000015003
AA Change: F353L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015003
Gene: ENSMUSG00000014859
AA Change: F353L

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
E2F_TDP 17 83 3.56e-31 SMART
Pfam:E2F_CC-MB 100 196 2.8e-36 PFAM
low complexity region 201 252 N/A INTRINSIC
low complexity region 360 372 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093622
Predicted Effect probably benign
Transcript: ENSMUST00000109375
SMART Domains Protein: ENSMUSP00000105000
Gene: ENSMUSG00000014791

DomainStartEndE-ValueType
Pfam:DUF3361 115 268 3.8e-55 PFAM
Pfam:ELMO_CED12 291 468 1.1e-42 PFAM
PH 542 665 2.17e0 SMART
low complexity region 694 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184892
Predicted Effect probably benign
Transcript: ENSMUST00000212033
Predicted Effect probably benign
Transcript: ENSMUST00000212046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212345
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionally conserved domains found in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein binds to all three of the tumor suppressor proteins pRB, p107 and p130, but with higher affinity to the last two. It plays an important role in the suppression of proliferation-associated genes, and its gene mutation and increased expression may be associated with human cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die postnatally of an increased susceptibility to bacterial infection and exhibit craniofacial defects, erythroid abnormalities, and growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cand2 A G 6: 115,764,197 (GRCm39) M324V probably damaging Het
Cap1 C T 4: 122,756,512 (GRCm39) V340M probably benign Het
Ccdc110 T C 8: 46,388,175 (GRCm39) V44A possibly damaging Het
Cps1 A G 1: 67,183,059 (GRCm39) D139G probably benign Het
Cwc27 T A 13: 104,768,124 (GRCm39) E457V unknown Het
Cxxc1 C T 18: 74,351,962 (GRCm39) P280S probably benign Het
Dennd2b A T 7: 109,140,635 (GRCm39) V197D probably damaging Het
Dop1b T A 16: 93,559,393 (GRCm39) L595Q probably benign Het
Dscam G T 16: 96,453,372 (GRCm39) S1292R possibly damaging Het
Ep300 A G 15: 81,485,097 (GRCm39) probably benign Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
Fign T A 2: 63,811,135 (GRCm39) H45L probably damaging Het
Flcn T A 11: 59,685,025 (GRCm39) probably benign Het
Gm5141 A T 13: 62,922,408 (GRCm39) F254I probably damaging Het
Gpbp1l1 T A 4: 116,448,465 (GRCm39) N402K probably damaging Het
Gpr37 A T 6: 25,669,823 (GRCm39) C340* probably null Het
Gtf3c2 A T 5: 31,315,476 (GRCm39) probably benign Het
Hcfc2 T A 10: 82,574,242 (GRCm39) F139I probably damaging Het
Hectd4 T C 5: 121,486,539 (GRCm39) L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 44,986,659 (GRCm39) probably benign Het
Igf2bp1 A G 11: 95,857,622 (GRCm39) probably benign Het
Igsf9b T G 9: 27,244,358 (GRCm39) probably null Het
Il23r G A 6: 67,403,572 (GRCm39) A443V probably benign Het
Kcnv1 A G 15: 44,972,645 (GRCm39) F413L probably damaging Het
Lipe C A 7: 25,087,611 (GRCm39) A150S possibly damaging Het
Lrrcc1 T C 3: 14,622,333 (GRCm39) S557P probably damaging Het
Mrpl54 C A 10: 81,102,687 (GRCm39) W13L probably damaging Het
Mtcl3 T A 10: 29,056,952 (GRCm39) probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Npy1r C A 8: 67,157,670 (GRCm39) Q327K probably damaging Het
Nt5el C A 13: 105,218,762 (GRCm39) S32* probably null Het
Or51b17 C T 7: 103,542,438 (GRCm39) R168H probably benign Het
Osbpl10 C T 9: 114,996,246 (GRCm39) L139F probably damaging Het
P2rx6 A C 16: 17,385,768 (GRCm39) T199P probably damaging Het
Phyhip A T 14: 70,699,199 (GRCm39) M1L possibly damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Psmc1 T A 12: 100,086,389 (GRCm39) I342N possibly damaging Het
Reln A T 5: 22,152,406 (GRCm39) D2353E probably damaging Het
Rmdn3 T C 2: 118,976,851 (GRCm39) E294G probably benign Het
Scnn1g A G 7: 121,366,647 (GRCm39) M615V probably benign Het
Shcbp1l T A 1: 153,304,314 (GRCm39) D124E possibly damaging Het
Sipa1l1 T C 12: 82,472,054 (GRCm39) S1345P possibly damaging Het
Taf7l2 T C 10: 115,948,707 (GRCm39) E273G possibly damaging Het
Timp4 A G 6: 115,226,802 (GRCm39) Y114H probably damaging Het
Tlr9 T A 9: 106,102,086 (GRCm39) L459Q probably benign Het
Tmem104 C A 11: 115,091,654 (GRCm39) T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Zfp622 A T 15: 25,984,654 (GRCm39) I7F possibly damaging Het
Other mutations in E2f4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:E2f4 APN 8 106,030,809 (GRCm39) unclassified probably benign
IGL01642:E2f4 APN 8 106,027,968 (GRCm39) missense probably damaging 1.00
R0488:E2f4 UTSW 8 106,025,171 (GRCm39) missense probably damaging 0.97
R0835:E2f4 UTSW 8 106,027,140 (GRCm39) nonsense probably null
R1548:E2f4 UTSW 8 106,031,320 (GRCm39) makesense probably null
R2120:E2f4 UTSW 8 106,026,973 (GRCm39) missense probably damaging 1.00
R2233:E2f4 UTSW 8 106,025,283 (GRCm39) missense probably damaging 1.00
R2235:E2f4 UTSW 8 106,025,283 (GRCm39) missense probably damaging 1.00
R7369:E2f4 UTSW 8 106,026,966 (GRCm39) missense probably benign 0.00
R7731:E2f4 UTSW 8 106,025,265 (GRCm39) missense probably damaging 0.99
R8265:E2f4 UTSW 8 106,027,977 (GRCm39) missense probably damaging 1.00
R8293:E2f4 UTSW 8 106,024,451 (GRCm39) missense probably damaging 0.98
R9283:E2f4 UTSW 8 106,024,395 (GRCm39) missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TTGGCTCAGCATCGAAGAATGTAGG -3'
(R):5'- AGCTCATGCACTCTGGGAATGAAC -3'

Sequencing Primer
(F):5'- GCATCGAAGAATGTAGGTCAGC -3'
(R):5'- ACACAATTCATTCAGATTCTGGCTC -3'
Posted On 2013-06-12