Incidental Mutation 'R0534:Pkd1l3'
ID 49372
Institutional Source Beutler Lab
Gene Symbol Pkd1l3
Ensembl Gene ENSMUSG00000048827
Gene Name polycystic kidney disease 1 like 3
Synonyms
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0534 (G1)
Quality Score 83
Status Validated
Chromosome 8
Chromosomal Location 110340828-110399305 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 110350281 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 375 (D375E)
Ref Sequence ENSEMBL: ENSMUSP00000148592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057344] [ENSMUST00000109242] [ENSMUST00000212537]
AlphaFold Q2EG98
Predicted Effect possibly damaging
Transcript: ENSMUST00000057344
AA Change: D375E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051512
Gene: ENSMUSG00000048827
AA Change: D375E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.25e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 431 1.22e-8 PROSPERO
internal_repeat_2 378 466 2.25e-8 PROSPERO
internal_repeat_1 518 731 1.22e-8 PROSPERO
GPS 1007 1056 3.62e-5 SMART
transmembrane domain 1075 1094 N/A INTRINSIC
LH2 1119 1238 1.01e-9 SMART
transmembrane domain 1282 1304 N/A INTRINSIC
transmembrane domain 1319 1341 N/A INTRINSIC
low complexity region 1398 1408 N/A INTRINSIC
low complexity region 1451 1460 N/A INTRINSIC
low complexity region 1484 1497 N/A INTRINSIC
transmembrane domain 1534 1556 N/A INTRINSIC
transmembrane domain 1576 1595 N/A INTRINSIC
Pfam:PKD_channel 1695 2110 2.8e-86 PFAM
Pfam:Ion_trans 1858 2114 2.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109242
AA Change: D375E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104865
Gene: ENSMUSG00000048827
AA Change: D375E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CLECT 26 142 4.25e-1 SMART
internal_repeat_2 143 245 2.63e-8 PROSPERO
low complexity region 246 270 N/A INTRINSIC
low complexity region 272 296 N/A INTRINSIC
low complexity region 298 322 N/A INTRINSIC
low complexity region 324 348 N/A INTRINSIC
internal_repeat_1 349 440 3.96e-14 PROSPERO
internal_repeat_2 378 466 2.63e-8 PROSPERO
internal_repeat_1 518 724 3.96e-14 PROSPERO
GPS 1017 1066 3.62e-5 SMART
transmembrane domain 1085 1104 N/A INTRINSIC
LH2 1129 1248 1.01e-9 SMART
transmembrane domain 1292 1314 N/A INTRINSIC
transmembrane domain 1329 1351 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
low complexity region 1461 1470 N/A INTRINSIC
low complexity region 1494 1507 N/A INTRINSIC
transmembrane domain 1544 1566 N/A INTRINSIC
transmembrane domain 1586 1605 N/A INTRINSIC
Pfam:PKD_channel 1705 2120 1.3e-86 PFAM
Pfam:Ion_trans 1868 2124 4.3e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212537
AA Change: D375E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212609
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal and exhibit normal taste responsiveness in various behavioral and electrophysiological tests of taste function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cand2 A G 6: 115,764,197 (GRCm39) M324V probably damaging Het
Cap1 C T 4: 122,756,512 (GRCm39) V340M probably benign Het
Ccdc110 T C 8: 46,388,175 (GRCm39) V44A possibly damaging Het
Cps1 A G 1: 67,183,059 (GRCm39) D139G probably benign Het
Cwc27 T A 13: 104,768,124 (GRCm39) E457V unknown Het
Cxxc1 C T 18: 74,351,962 (GRCm39) P280S probably benign Het
Dennd2b A T 7: 109,140,635 (GRCm39) V197D probably damaging Het
Dop1b T A 16: 93,559,393 (GRCm39) L595Q probably benign Het
Dscam G T 16: 96,453,372 (GRCm39) S1292R possibly damaging Het
E2f4 C A 8: 106,030,851 (GRCm39) F353L probably damaging Het
Ep300 A G 15: 81,485,097 (GRCm39) probably benign Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
Fign T A 2: 63,811,135 (GRCm39) H45L probably damaging Het
Flcn T A 11: 59,685,025 (GRCm39) probably benign Het
Gm5141 A T 13: 62,922,408 (GRCm39) F254I probably damaging Het
Gpbp1l1 T A 4: 116,448,465 (GRCm39) N402K probably damaging Het
Gpr37 A T 6: 25,669,823 (GRCm39) C340* probably null Het
Gtf3c2 A T 5: 31,315,476 (GRCm39) probably benign Het
Hcfc2 T A 10: 82,574,242 (GRCm39) F139I probably damaging Het
Hectd4 T C 5: 121,486,539 (GRCm39) L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 44,986,659 (GRCm39) probably benign Het
Igf2bp1 A G 11: 95,857,622 (GRCm39) probably benign Het
Igsf9b T G 9: 27,244,358 (GRCm39) probably null Het
Il23r G A 6: 67,403,572 (GRCm39) A443V probably benign Het
Kcnv1 A G 15: 44,972,645 (GRCm39) F413L probably damaging Het
Lipe C A 7: 25,087,611 (GRCm39) A150S possibly damaging Het
Lrrcc1 T C 3: 14,622,333 (GRCm39) S557P probably damaging Het
Mrpl54 C A 10: 81,102,687 (GRCm39) W13L probably damaging Het
Mtcl3 T A 10: 29,056,952 (GRCm39) probably benign Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Npy1r C A 8: 67,157,670 (GRCm39) Q327K probably damaging Het
Nt5el C A 13: 105,218,762 (GRCm39) S32* probably null Het
Or51b17 C T 7: 103,542,438 (GRCm39) R168H probably benign Het
Osbpl10 C T 9: 114,996,246 (GRCm39) L139F probably damaging Het
P2rx6 A C 16: 17,385,768 (GRCm39) T199P probably damaging Het
Phyhip A T 14: 70,699,199 (GRCm39) M1L possibly damaging Het
Psmc1 T A 12: 100,086,389 (GRCm39) I342N possibly damaging Het
Reln A T 5: 22,152,406 (GRCm39) D2353E probably damaging Het
Rmdn3 T C 2: 118,976,851 (GRCm39) E294G probably benign Het
Scnn1g A G 7: 121,366,647 (GRCm39) M615V probably benign Het
Shcbp1l T A 1: 153,304,314 (GRCm39) D124E possibly damaging Het
Sipa1l1 T C 12: 82,472,054 (GRCm39) S1345P possibly damaging Het
Taf7l2 T C 10: 115,948,707 (GRCm39) E273G possibly damaging Het
Timp4 A G 6: 115,226,802 (GRCm39) Y114H probably damaging Het
Tlr9 T A 9: 106,102,086 (GRCm39) L459Q probably benign Het
Tmem104 C A 11: 115,091,654 (GRCm39) T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Zfp622 A T 15: 25,984,654 (GRCm39) I7F possibly damaging Het
Other mutations in Pkd1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Pkd1l3 APN 8 110,356,869 (GRCm39) missense possibly damaging 0.53
IGL00562:Pkd1l3 APN 8 110,382,779 (GRCm39) missense possibly damaging 0.53
IGL00563:Pkd1l3 APN 8 110,382,779 (GRCm39) missense possibly damaging 0.53
IGL01061:Pkd1l3 APN 8 110,365,338 (GRCm39) missense probably damaging 1.00
IGL01105:Pkd1l3 APN 8 110,388,873 (GRCm39) missense possibly damaging 0.81
IGL01574:Pkd1l3 APN 8 110,350,403 (GRCm39) missense probably benign 0.01
IGL01597:Pkd1l3 APN 8 110,350,153 (GRCm39) missense probably benign 0.33
IGL01634:Pkd1l3 APN 8 110,394,157 (GRCm39) critical splice acceptor site probably null
IGL01645:Pkd1l3 APN 8 110,361,934 (GRCm39) missense possibly damaging 0.59
IGL01770:Pkd1l3 APN 8 110,375,134 (GRCm39) critical splice acceptor site probably null
IGL01837:Pkd1l3 APN 8 110,356,798 (GRCm39) missense possibly damaging 0.85
IGL01862:Pkd1l3 APN 8 110,357,908 (GRCm39) critical splice acceptor site probably null
IGL01938:Pkd1l3 APN 8 110,361,933 (GRCm39) missense probably benign 0.00
IGL01990:Pkd1l3 APN 8 110,387,438 (GRCm39) missense probably damaging 1.00
IGL02056:Pkd1l3 APN 8 110,358,010 (GRCm39) missense probably benign 0.14
IGL02069:Pkd1l3 APN 8 110,362,012 (GRCm39) missense probably damaging 1.00
IGL02086:Pkd1l3 APN 8 110,392,217 (GRCm39) missense probably damaging 1.00
IGL02152:Pkd1l3 APN 8 110,395,924 (GRCm39) missense probably damaging 1.00
IGL02209:Pkd1l3 APN 8 110,365,296 (GRCm39) missense probably damaging 1.00
IGL02213:Pkd1l3 APN 8 110,357,977 (GRCm39) missense probably damaging 1.00
IGL02218:Pkd1l3 APN 8 110,387,434 (GRCm39) missense possibly damaging 0.92
IGL02225:Pkd1l3 APN 8 110,365,310 (GRCm39) missense probably damaging 1.00
IGL02252:Pkd1l3 APN 8 110,357,708 (GRCm39) missense possibly damaging 0.92
IGL02351:Pkd1l3 APN 8 110,373,129 (GRCm39) unclassified probably benign
IGL02358:Pkd1l3 APN 8 110,373,129 (GRCm39) unclassified probably benign
IGL02369:Pkd1l3 APN 8 110,342,977 (GRCm39) missense unknown
IGL02481:Pkd1l3 APN 8 110,341,414 (GRCm39) missense unknown
IGL02505:Pkd1l3 APN 8 110,359,848 (GRCm39) missense probably damaging 1.00
IGL02506:Pkd1l3 APN 8 110,374,132 (GRCm39) missense probably damaging 1.00
IGL02535:Pkd1l3 APN 8 110,367,522 (GRCm39) nonsense probably null
IGL02715:Pkd1l3 APN 8 110,353,458 (GRCm39) missense probably damaging 0.96
IGL02979:Pkd1l3 APN 8 110,388,736 (GRCm39) splice site probably benign
IGL03059:Pkd1l3 APN 8 110,374,999 (GRCm39) missense probably damaging 1.00
IGL03090:Pkd1l3 APN 8 110,382,165 (GRCm39) nonsense probably null
IGL03206:Pkd1l3 APN 8 110,350,345 (GRCm39) missense probably benign 0.18
IGL03328:Pkd1l3 APN 8 110,388,738 (GRCm39) splice site probably benign
BB006:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
PIT4453001:Pkd1l3 UTSW 8 110,387,433 (GRCm39) missense probably damaging 0.99
PIT4468001:Pkd1l3 UTSW 8 110,391,131 (GRCm39) missense possibly damaging 0.85
R0001:Pkd1l3 UTSW 8 110,355,265 (GRCm39) splice site probably benign
R0066:Pkd1l3 UTSW 8 110,347,103 (GRCm39) missense unknown
R0066:Pkd1l3 UTSW 8 110,347,103 (GRCm39) missense unknown
R0233:Pkd1l3 UTSW 8 110,377,412 (GRCm39) nonsense probably null
R0233:Pkd1l3 UTSW 8 110,377,412 (GRCm39) nonsense probably null
R0255:Pkd1l3 UTSW 8 110,365,386 (GRCm39) missense probably damaging 1.00
R0288:Pkd1l3 UTSW 8 110,373,131 (GRCm39) splice site probably null
R0311:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0311:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0403:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0403:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0441:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0446:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0465:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0465:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0466:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0467:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0468:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0488:Pkd1l3 UTSW 8 110,350,295 (GRCm39) missense probably benign 0.33
R0488:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0515:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0650:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R0689:Pkd1l3 UTSW 8 110,350,281 (GRCm39) missense possibly damaging 0.70
R1422:Pkd1l3 UTSW 8 110,348,340 (GRCm39) missense unknown
R1464:Pkd1l3 UTSW 8 110,363,059 (GRCm39) splice site probably benign
R1467:Pkd1l3 UTSW 8 110,343,000 (GRCm39) missense unknown
R1467:Pkd1l3 UTSW 8 110,343,000 (GRCm39) missense unknown
R1469:Pkd1l3 UTSW 8 110,373,585 (GRCm39) missense possibly damaging 0.72
R1469:Pkd1l3 UTSW 8 110,373,585 (GRCm39) missense possibly damaging 0.72
R1509:Pkd1l3 UTSW 8 110,367,402 (GRCm39) missense probably damaging 0.99
R1561:Pkd1l3 UTSW 8 110,341,445 (GRCm39) missense unknown
R1574:Pkd1l3 UTSW 8 110,341,445 (GRCm39) missense unknown
R1599:Pkd1l3 UTSW 8 110,363,016 (GRCm39) missense probably benign 0.01
R1688:Pkd1l3 UTSW 8 110,350,450 (GRCm39) missense probably benign 0.18
R1792:Pkd1l3 UTSW 8 110,359,237 (GRCm39) missense probably damaging 1.00
R1818:Pkd1l3 UTSW 8 110,375,038 (GRCm39) missense probably benign 0.03
R1896:Pkd1l3 UTSW 8 110,350,831 (GRCm39) missense possibly damaging 0.92
R2105:Pkd1l3 UTSW 8 110,374,205 (GRCm39) nonsense probably null
R2185:Pkd1l3 UTSW 8 110,359,827 (GRCm39) missense possibly damaging 0.95
R2192:Pkd1l3 UTSW 8 110,347,156 (GRCm39) missense unknown
R2260:Pkd1l3 UTSW 8 110,350,268 (GRCm39) missense probably benign 0.18
R2363:Pkd1l3 UTSW 8 110,355,341 (GRCm39) missense probably benign 0.01
R2418:Pkd1l3 UTSW 8 110,397,353 (GRCm39) makesense probably null
R2435:Pkd1l3 UTSW 8 110,377,334 (GRCm39) missense probably benign 0.07
R2443:Pkd1l3 UTSW 8 110,350,447 (GRCm39) missense probably benign 0.18
R2850:Pkd1l3 UTSW 8 110,350,622 (GRCm39) missense possibly damaging 0.92
R2910:Pkd1l3 UTSW 8 110,394,268 (GRCm39) splice site probably benign
R3755:Pkd1l3 UTSW 8 110,359,171 (GRCm39) missense probably damaging 1.00
R3791:Pkd1l3 UTSW 8 110,362,949 (GRCm39) missense probably damaging 0.99
R3905:Pkd1l3 UTSW 8 110,373,511 (GRCm39) missense probably benign 0.02
R4027:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4028:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4029:Pkd1l3 UTSW 8 110,350,603 (GRCm39) missense possibly damaging 0.68
R4274:Pkd1l3 UTSW 8 110,350,751 (GRCm39) missense possibly damaging 0.92
R4461:Pkd1l3 UTSW 8 110,359,345 (GRCm39) splice site probably null
R4893:Pkd1l3 UTSW 8 110,365,026 (GRCm39) missense probably benign 0.15
R4907:Pkd1l3 UTSW 8 110,367,475 (GRCm39) missense probably damaging 0.99
R5037:Pkd1l3 UTSW 8 110,392,268 (GRCm39) missense probably damaging 1.00
R5045:Pkd1l3 UTSW 8 110,349,787 (GRCm39) missense unknown
R5207:Pkd1l3 UTSW 8 110,359,823 (GRCm39) missense probably damaging 1.00
R5307:Pkd1l3 UTSW 8 110,367,424 (GRCm39) missense probably damaging 1.00
R5408:Pkd1l3 UTSW 8 110,393,684 (GRCm39) missense probably damaging 1.00
R5595:Pkd1l3 UTSW 8 110,382,152 (GRCm39) missense probably damaging 1.00
R5615:Pkd1l3 UTSW 8 110,356,842 (GRCm39) missense probably benign
R5623:Pkd1l3 UTSW 8 110,350,351 (GRCm39) missense possibly damaging 0.53
R5896:Pkd1l3 UTSW 8 110,353,468 (GRCm39) missense probably damaging 1.00
R6101:Pkd1l3 UTSW 8 110,367,478 (GRCm39) missense probably damaging 1.00
R6105:Pkd1l3 UTSW 8 110,367,478 (GRCm39) missense probably damaging 1.00
R6170:Pkd1l3 UTSW 8 110,349,811 (GRCm39) missense unknown
R6330:Pkd1l3 UTSW 8 110,373,541 (GRCm39) missense probably benign 0.00
R6346:Pkd1l3 UTSW 8 110,358,016 (GRCm39) missense probably damaging 0.98
R6395:Pkd1l3 UTSW 8 110,350,595 (GRCm39) missense probably benign 0.20
R6475:Pkd1l3 UTSW 8 110,349,844 (GRCm39) missense unknown
R6480:Pkd1l3 UTSW 8 110,365,019 (GRCm39) nonsense probably null
R6519:Pkd1l3 UTSW 8 110,355,404 (GRCm39) missense probably benign
R6654:Pkd1l3 UTSW 8 110,350,915 (GRCm39) missense probably benign 0.23
R6717:Pkd1l3 UTSW 8 110,341,401 (GRCm39) missense unknown
R6733:Pkd1l3 UTSW 8 110,375,126 (GRCm39) splice site probably null
R6753:Pkd1l3 UTSW 8 110,351,081 (GRCm39) missense probably damaging 1.00
R6777:Pkd1l3 UTSW 8 110,353,446 (GRCm39) missense probably benign 0.00
R6901:Pkd1l3 UTSW 8 110,341,246 (GRCm39) missense unknown
R6975:Pkd1l3 UTSW 8 110,387,539 (GRCm39) missense possibly damaging 0.73
R6991:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7018:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7083:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7139:Pkd1l3 UTSW 8 110,362,972 (GRCm39) missense probably damaging 0.96
R7153:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7235:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7238:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7252:Pkd1l3 UTSW 8 110,387,330 (GRCm39) missense probably benign 0.01
R7296:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7309:Pkd1l3 UTSW 8 110,374,893 (GRCm39) splice site probably null
R7362:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7462:Pkd1l3 UTSW 8 110,355,409 (GRCm39) missense probably benign 0.00
R7470:Pkd1l3 UTSW 8 110,365,008 (GRCm39) missense probably benign 0.09
R7478:Pkd1l3 UTSW 8 110,359,947 (GRCm39) missense probably damaging 1.00
R7483:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7516:Pkd1l3 UTSW 8 110,361,861 (GRCm39) missense probably damaging 1.00
R7553:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7559:Pkd1l3 UTSW 8 110,351,072 (GRCm39) missense probably benign 0.03
R7650:Pkd1l3 UTSW 8 110,399,217 (GRCm39) missense probably benign 0.23
R7654:Pkd1l3 UTSW 8 110,365,049 (GRCm39) missense probably damaging 1.00
R7742:Pkd1l3 UTSW 8 110,341,204 (GRCm39) missense unknown
R7749:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7751:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7755:Pkd1l3 UTSW 8 110,356,798 (GRCm39) missense possibly damaging 0.85
R7816:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7831:Pkd1l3 UTSW 8 110,357,990 (GRCm39) missense possibly damaging 0.47
R7835:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7849:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R7917:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7929:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R7952:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8054:Pkd1l3 UTSW 8 110,373,008 (GRCm39) missense probably damaging 1.00
R8098:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8099:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8276:Pkd1l3 UTSW 8 110,397,353 (GRCm39) makesense probably null
R8352:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8376:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R8377:Pkd1l3 UTSW 8 110,361,982 (GRCm39) missense probably benign 0.08
R8398:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8399:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8400:Pkd1l3 UTSW 8 110,350,520 (GRCm39) missense possibly damaging 0.93
R8412:Pkd1l3 UTSW 8 110,360,022 (GRCm39) missense possibly damaging 0.85
R8530:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8539:Pkd1l3 UTSW 8 110,362,919 (GRCm39) missense probably damaging 1.00
R8546:Pkd1l3 UTSW 8 110,393,615 (GRCm39) missense possibly damaging 0.52
R8558:Pkd1l3 UTSW 8 110,362,012 (GRCm39) missense probably damaging 1.00
R8719:Pkd1l3 UTSW 8 110,341,255 (GRCm39) missense unknown
R8769:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8797:Pkd1l3 UTSW 8 110,374,946 (GRCm39) missense probably benign 0.15
R8840:Pkd1l3 UTSW 8 110,349,842 (GRCm39) missense unknown
R8846:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8874:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8893:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8956:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8963:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R8968:Pkd1l3 UTSW 8 110,350,420 (GRCm39) small deletion probably benign
R9035:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9054:Pkd1l3 UTSW 8 110,392,304 (GRCm39) missense probably benign 0.08
R9058:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9119:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9134:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9138:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9158:Pkd1l3 UTSW 8 110,394,207 (GRCm39) nonsense probably null
R9180:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9181:Pkd1l3 UTSW 8 110,375,318 (GRCm39) missense probably damaging 0.98
R9218:Pkd1l3 UTSW 8 110,382,128 (GRCm39) nonsense probably null
R9249:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9269:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9338:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9383:Pkd1l3 UTSW 8 110,350,601 (GRCm39) small deletion probably benign
R9396:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9423:Pkd1l3 UTSW 8 110,350,312 (GRCm39) missense possibly damaging 0.53
R9514:Pkd1l3 UTSW 8 110,395,849 (GRCm39) missense probably damaging 1.00
R9515:Pkd1l3 UTSW 8 110,395,849 (GRCm39) missense probably damaging 1.00
R9567:Pkd1l3 UTSW 8 110,394,173 (GRCm39) missense probably damaging 0.99
R9668:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9684:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
R9748:Pkd1l3 UTSW 8 110,373,555 (GRCm39) missense probably benign 0.00
R9778:Pkd1l3 UTSW 8 110,357,937 (GRCm39) missense probably benign 0.00
RF016:Pkd1l3 UTSW 8 110,350,174 (GRCm39) missense probably benign 0.18
RF029:Pkd1l3 UTSW 8 110,350,827 (GRCm39) small deletion probably benign
X0026:Pkd1l3 UTSW 8 110,341,185 (GRCm39) missense probably null
Z1176:Pkd1l3 UTSW 8 110,349,874 (GRCm39) missense unknown
Z31818:Pkd1l3 UTSW 8 110,395,924 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACATCAGACACACTTGCATCC -3'
(R):5'- ACCTGTGTTGGGCTGCTGAATC -3'

Sequencing Primer
(F):5'- ACTTGCATCCAGCAGCC -3'
(R):5'- GCTGCTGAATCCAGGTGTG -3'
Posted On 2013-06-12