Incidental Mutation 'R0534:Mtcl3'
ID 49375
Institutional Source Beutler Lab
Gene Symbol Mtcl3
Ensembl Gene ENSMUSG00000038916
Gene Name MTCL family member 3
Synonyms Soga3, 6330407J23Rik
MMRRC Submission 038726-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.137) question?
Stock # R0534 (G1)
Quality Score 133
Status Validated
Chromosome 10
Chromosomal Location 29019992-29075626 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 29056952 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000092629]
AlphaFold Q6NZL0
Predicted Effect probably benign
Transcript: ENSMUST00000092629
SMART Domains Protein: ENSMUSP00000090293
Gene: ENSMUSG00000038916

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 158 185 N/A INTRINSIC
low complexity region 214 247 N/A INTRINSIC
SCOP:d1fxkc_ 354 488 2e-4 SMART
Blast:BRLZ 356 384 6e-10 BLAST
Pfam:DUF3166 519 613 1.8e-34 PFAM
Pfam:DUF3166 639 727 4.6e-34 PFAM
transmembrane domain 917 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214863
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cand2 A G 6: 115,764,197 (GRCm39) M324V probably damaging Het
Cap1 C T 4: 122,756,512 (GRCm39) V340M probably benign Het
Ccdc110 T C 8: 46,388,175 (GRCm39) V44A possibly damaging Het
Cps1 A G 1: 67,183,059 (GRCm39) D139G probably benign Het
Cwc27 T A 13: 104,768,124 (GRCm39) E457V unknown Het
Cxxc1 C T 18: 74,351,962 (GRCm39) P280S probably benign Het
Dennd2b A T 7: 109,140,635 (GRCm39) V197D probably damaging Het
Dop1b T A 16: 93,559,393 (GRCm39) L595Q probably benign Het
Dscam G T 16: 96,453,372 (GRCm39) S1292R possibly damaging Het
E2f4 C A 8: 106,030,851 (GRCm39) F353L probably damaging Het
Ep300 A G 15: 81,485,097 (GRCm39) probably benign Het
Fads1 C T 19: 10,160,429 (GRCm39) P5L probably benign Het
Fign T A 2: 63,811,135 (GRCm39) H45L probably damaging Het
Flcn T A 11: 59,685,025 (GRCm39) probably benign Het
Gm5141 A T 13: 62,922,408 (GRCm39) F254I probably damaging Het
Gpbp1l1 T A 4: 116,448,465 (GRCm39) N402K probably damaging Het
Gpr37 A T 6: 25,669,823 (GRCm39) C340* probably null Het
Gtf3c2 A T 5: 31,315,476 (GRCm39) probably benign Het
Hcfc2 T A 10: 82,574,242 (GRCm39) F139I probably damaging Het
Hectd4 T C 5: 121,486,539 (GRCm39) L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 44,986,659 (GRCm39) probably benign Het
Igf2bp1 A G 11: 95,857,622 (GRCm39) probably benign Het
Igsf9b T G 9: 27,244,358 (GRCm39) probably null Het
Il23r G A 6: 67,403,572 (GRCm39) A443V probably benign Het
Kcnv1 A G 15: 44,972,645 (GRCm39) F413L probably damaging Het
Lipe C A 7: 25,087,611 (GRCm39) A150S possibly damaging Het
Lrrcc1 T C 3: 14,622,333 (GRCm39) S557P probably damaging Het
Mrpl54 C A 10: 81,102,687 (GRCm39) W13L probably damaging Het
Myrf G C 19: 10,195,526 (GRCm39) T428S probably benign Het
Npy1r C A 8: 67,157,670 (GRCm39) Q327K probably damaging Het
Nt5el C A 13: 105,218,762 (GRCm39) S32* probably null Het
Or51b17 C T 7: 103,542,438 (GRCm39) R168H probably benign Het
Osbpl10 C T 9: 114,996,246 (GRCm39) L139F probably damaging Het
P2rx6 A C 16: 17,385,768 (GRCm39) T199P probably damaging Het
Phyhip A T 14: 70,699,199 (GRCm39) M1L possibly damaging Het
Pkd1l3 C G 8: 110,350,281 (GRCm39) D375E possibly damaging Het
Psmc1 T A 12: 100,086,389 (GRCm39) I342N possibly damaging Het
Reln A T 5: 22,152,406 (GRCm39) D2353E probably damaging Het
Rmdn3 T C 2: 118,976,851 (GRCm39) E294G probably benign Het
Scnn1g A G 7: 121,366,647 (GRCm39) M615V probably benign Het
Shcbp1l T A 1: 153,304,314 (GRCm39) D124E possibly damaging Het
Sipa1l1 T C 12: 82,472,054 (GRCm39) S1345P possibly damaging Het
Taf7l2 T C 10: 115,948,707 (GRCm39) E273G possibly damaging Het
Timp4 A G 6: 115,226,802 (GRCm39) Y114H probably damaging Het
Tlr9 T A 9: 106,102,086 (GRCm39) L459Q probably benign Het
Tmem104 C A 11: 115,091,654 (GRCm39) T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Zfp622 A T 15: 25,984,654 (GRCm39) I7F possibly damaging Het
Other mutations in Mtcl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Mtcl3 APN 10 29,072,469 (GRCm39) nonsense probably null
IGL00929:Mtcl3 APN 10 29,024,288 (GRCm39) missense probably damaging 0.99
IGL01450:Mtcl3 APN 10 29,072,319 (GRCm39) missense probably damaging 1.00
IGL01462:Mtcl3 APN 10 29,024,254 (GRCm39) missense probably damaging 1.00
IGL03062:Mtcl3 APN 10 29,074,945 (GRCm39) missense probably damaging 1.00
R1355:Mtcl3 UTSW 10 29,023,318 (GRCm39) missense probably benign 0.01
R1450:Mtcl3 UTSW 10 29,023,736 (GRCm39) missense probably damaging 1.00
R1654:Mtcl3 UTSW 10 29,022,931 (GRCm39) splice site probably null
R1680:Mtcl3 UTSW 10 29,072,835 (GRCm39) missense probably damaging 1.00
R2134:Mtcl3 UTSW 10 29,072,395 (GRCm39) nonsense probably null
R2570:Mtcl3 UTSW 10 29,022,761 (GRCm39) missense possibly damaging 0.88
R4395:Mtcl3 UTSW 10 29,023,351 (GRCm39) missense probably benign
R4859:Mtcl3 UTSW 10 29,026,390 (GRCm39) missense probably benign 0.00
R4883:Mtcl3 UTSW 10 29,072,537 (GRCm39) missense probably damaging 1.00
R4884:Mtcl3 UTSW 10 29,072,537 (GRCm39) missense probably damaging 1.00
R5288:Mtcl3 UTSW 10 29,072,766 (GRCm39) missense probably benign 0.00
R5335:Mtcl3 UTSW 10 29,023,102 (GRCm39) missense probably benign
R5384:Mtcl3 UTSW 10 29,072,766 (GRCm39) missense probably benign 0.00
R5385:Mtcl3 UTSW 10 29,072,766 (GRCm39) missense probably benign 0.00
R5457:Mtcl3 UTSW 10 29,072,720 (GRCm39) missense probably benign 0.01
R5813:Mtcl3 UTSW 10 29,026,240 (GRCm39) missense probably damaging 1.00
R5819:Mtcl3 UTSW 10 29,073,269 (GRCm39) missense probably benign 0.00
R5950:Mtcl3 UTSW 10 29,019,644 (GRCm39) unclassified probably benign
R6567:Mtcl3 UTSW 10 29,023,279 (GRCm39) missense probably benign 0.00
R7312:Mtcl3 UTSW 10 29,073,240 (GRCm39) missense probably damaging 1.00
R7313:Mtcl3 UTSW 10 29,072,875 (GRCm39) nonsense probably null
R7445:Mtcl3 UTSW 10 29,072,999 (GRCm39) missense possibly damaging 0.91
R7481:Mtcl3 UTSW 10 29,072,519 (GRCm39) missense probably damaging 1.00
R7609:Mtcl3 UTSW 10 29,024,224 (GRCm39) missense probably damaging 1.00
R7616:Mtcl3 UTSW 10 29,022,574 (GRCm39) start gained probably benign
R7665:Mtcl3 UTSW 10 29,072,393 (GRCm39) missense probably damaging 1.00
R8125:Mtcl3 UTSW 10 29,072,894 (GRCm39) missense probably damaging 1.00
R8153:Mtcl3 UTSW 10 29,024,235 (GRCm39) nonsense probably null
R8220:Mtcl3 UTSW 10 29,023,264 (GRCm39) nonsense probably null
R8260:Mtcl3 UTSW 10 29,024,270 (GRCm39) missense possibly damaging 0.91
R8749:Mtcl3 UTSW 10 29,072,721 (GRCm39) missense possibly damaging 0.95
R9225:Mtcl3 UTSW 10 29,072,327 (GRCm39) nonsense probably null
R9364:Mtcl3 UTSW 10 29,072,775 (GRCm39) missense probably damaging 0.98
R9484:Mtcl3 UTSW 10 29,072,969 (GRCm39) missense probably damaging 1.00
R9518:Mtcl3 UTSW 10 29,022,748 (GRCm39) missense probably benign
R9546:Mtcl3 UTSW 10 29,022,805 (GRCm39) missense probably damaging 0.98
R9688:Mtcl3 UTSW 10 29,072,691 (GRCm39) missense possibly damaging 0.78
R9742:Mtcl3 UTSW 10 29,024,394 (GRCm39) missense probably benign 0.22
R9748:Mtcl3 UTSW 10 29,024,398 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACACTTGCCTCACTTGCCTAC -3'
(R):5'- TTTTACCACCCAAGTCTACAGCGAC -3'

Sequencing Primer
(F):5'- CACTGATCTGTATTTTGTCCAAGTTG -3'
(R):5'- TCTACAGCGACATAGTTGAGATGC -3'
Posted On 2013-06-12