Mutagenetix > Incidental Mutation

Incidental Mutation 'R0534:Flcn'

49378

Institutional Source

Beutler Lab

Gene Symbol

Flcn

Ensembl Gene

ENSMUSG00000032633

Gene Name

folliculin

Synonyms

B430214A04Rik, BHD

MMRRC Submission

038726-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0534 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59791408-59810016 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 59794199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099758 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091246] [ENSMUST00000102697]

AlphaFold

Q8QZS3

Predicted Effect

probably benign
Transcript: ENSMUST00000091246

SMART Domains

Protein: ENSMUSP00000091696
Gene: ENSMUSG00000032633

Domain	Start	End	E-Value	Type
low complexity region	62	79	N/A	INTRINSIC
Pfam:Folliculin	103	267	3.5e-59	PFAM
low complexity region	293	308	N/A	INTRINSIC
PDB:3V42\|B	342	566	1e-144	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000102697

SMART Domains

Protein: ENSMUSP00000099758
Gene: ENSMUSG00000032633

Domain	Start	End	E-Value	Type
low complexity region	62	79	N/A	INTRINSIC
Pfam:Folliculin	104	265	1.5e-55	PFAM
low complexity region	293	308	N/A	INTRINSIC
Pfam:Folliculin_C	344	566	8.4e-94	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148151

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two different knock-out alleles exhibit prenatal lethality. Mice homozygous for a gene-trapped allele show prenatal lethality while a fraction of heterozygotes develop spontaneous oncocytic renal cysts and solid renal tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	T	C	10: 116,112,802	E273G	possibly damaging	Het
4933425L06Rik	C	A	13: 105,082,254	S32*	probably null	Het
Cand2	A	G	6: 115,787,236	M324V	probably damaging	Het
Cap1	C	T	4: 122,862,719	V340M	probably benign	Het
Ccdc110	T	C	8: 45,935,138	V44A	possibly damaging	Het
Cps1	A	G	1: 67,143,900	D139G	probably benign	Het
Cwc27	T	A	13: 104,631,616	E457V	unknown	Het
Cxxc1	C	T	18: 74,218,891	P280S	probably benign	Het
Dopey2	T	A	16: 93,762,505	L595Q	probably benign	Het
Dscam	G	T	16: 96,652,172	S1292R	possibly damaging	Het
E2f4	C	A	8: 105,304,219	F353L	probably damaging	Het
Ep300	A	G	15: 81,600,896		probably benign	Het
Fads1	C	T	19: 10,183,065	P5L	probably benign	Het
Fign	T	A	2: 63,980,791	H45L	probably damaging	Het
Gm5141	A	T	13: 62,774,594	F254I	probably damaging	Het
Gpbp1l1	T	A	4: 116,591,268	N402K	probably damaging	Het
Gpr37	A	T	6: 25,669,824	C340*	probably null	Het
Gtf3c2	A	T	5: 31,158,132		probably benign	Het
Hcfc2	T	A	10: 82,738,408	F139I	probably damaging	Het
Hectd4	T	C	5: 121,348,476	L3178P	possibly damaging	Het
Hrc	AGAGGAGGAGGAAGAGGAGGAGGA	AGAGGAGGAGGAGGAAGAGGAGGAGGA	7: 45,337,235		probably benign	Het
Igf2bp1	A	G	11: 95,966,796		probably benign	Het
Igsf9b	T	G	9: 27,333,062		probably null	Het
Il23r	G	A	6: 67,426,588	A443V	probably benign	Het
Kcnv1	A	G	15: 45,109,249	F413L	probably damaging	Het
Lipe	C	A	7: 25,388,186	A150S	possibly damaging	Het
Lrrcc1	T	C	3: 14,557,273	S557P	probably damaging	Het
Mrpl54	C	A	10: 81,266,853	W13L	probably damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Npy1r	C	A	8: 66,705,018	Q327K	probably damaging	Het
Olfr64	C	T	7: 103,893,231	R168H	probably benign	Het
Osbpl10	C	T	9: 115,167,178	L139F	probably damaging	Het
P2rx6	A	C	16: 17,567,904	T199P	probably damaging	Het
Phyhip	A	T	14: 70,461,759	M1L	possibly damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Psmc1	T	A	12: 100,120,130	I342N	possibly damaging	Het
Reln	A	T	5: 21,947,408	D2353E	probably damaging	Het
Rmdn3	T	C	2: 119,146,370	E294G	probably benign	Het
Scnn1g	A	G	7: 121,767,424	M615V	probably benign	Het
Shcbp1l	T	A	1: 153,428,568	D124E	possibly damaging	Het
Sipa1l1	T	C	12: 82,425,280	S1345P	possibly damaging	Het
Soga3	T	A	10: 29,180,956		probably benign	Het
St5	A	T	7: 109,541,428	V197D	probably damaging	Het
Timp4	A	G	6: 115,249,841	Y114H	probably damaging	Het
Tlr9	T	A	9: 106,224,887	L459Q	probably benign	Het
Tmem104	C	A	11: 115,200,828	T59K	probably damaging	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Zfp622	A	T	15: 25,984,568	I7F	possibly damaging	Het

Other mutations in Flcn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Flcn	APN	11	59795823	missense	probably damaging	1.00
IGL01890:Flcn	APN	11	59795170	missense	probably benign	0.00
IGL02486:Flcn	APN	11	59801043	nonsense	probably null
IGL02933:Flcn	APN	11	59803757	missense	probably damaging	1.00
IGL02935:Flcn	APN	11	59795236	missense	possibly damaging	0.93
IGL03246:Flcn	APN	11	59794110	missense	possibly damaging	0.82
Pansy	UTSW	11	59792659	missense	probably damaging	0.99
R0238:Flcn	UTSW	11	59801076	missense	probably benign	0.00
R0238:Flcn	UTSW	11	59801076	missense	probably benign	0.00
R0239:Flcn	UTSW	11	59801076	missense	probably benign	0.00
R0239:Flcn	UTSW	11	59801076	missense	probably benign	0.00
R0265:Flcn	UTSW	11	59795809	nonsense	probably null
R0551:Flcn	UTSW	11	59795748	critical splice donor site	probably null
R1016:Flcn	UTSW	11	59795865	critical splice acceptor site	probably null
R1108:Flcn	UTSW	11	59801200	missense	possibly damaging	0.77
R2350:Flcn	UTSW	11	59792659	missense	probably damaging	0.99
R4158:Flcn	UTSW	11	59801121	missense	probably benign	0.26
R4367:Flcn	UTSW	11	59803784	missense	possibly damaging	0.90
R4371:Flcn	UTSW	11	59803784	missense	possibly damaging	0.90
R4612:Flcn	UTSW	11	59792687	missense	probably damaging	1.00
R4689:Flcn	UTSW	11	59801044	missense	possibly damaging	0.87
R5849:Flcn	UTSW	11	59804760	missense	probably damaging	0.99
R6007:Flcn	UTSW	11	59792622	missense	probably benign	0.08
R6433:Flcn	UTSW	11	59801082	missense	probably damaging	0.97
R6525:Flcn	UTSW	11	59794172	missense	possibly damaging	0.75
R7027:Flcn	UTSW	11	59795806	missense	probably damaging	1.00
R7632:Flcn	UTSW	11	59795799	nonsense	probably null
R8018:Flcn	UTSW	11	59794122	missense	probably damaging	0.97
R9011:Flcn	UTSW	11	59799407	missense	possibly damaging	0.82
R9414:Flcn	UTSW	11	59794172	missense	possibly damaging	0.75
R9453:Flcn	UTSW	11	59803783	missense	probably damaging	0.99
R9458:Flcn	UTSW	11	59799382	missense	possibly damaging	0.88
R9748:Flcn	UTSW	11	59802154	missense	probably benign	0.03
X0002:Flcn	UTSW	11	59804537	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAAAGCCACAGAGAGCTGCTCTAC -3'
(R):5'- GCAGTGCAGTCAAGGGTCACTTTAC -3'

Sequencing Primer
(F):5'- GAGAGCTGCTCTACCCCTTG -3'
(R):5'- GCCACAGAGTTCGTAGTTGTC -3'

Posted On

2013-06-12