Incidental Mutation 'R0534:Flcn'
ID49378
Institutional Source Beutler Lab
Gene Symbol Flcn
Ensembl Gene ENSMUSG00000032633
Gene Namefolliculin
SynonymsB430214A04Rik, BHD
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0534 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59791408-59810016 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 59794199 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091246] [ENSMUST00000102697]
Predicted Effect probably benign
Transcript: ENSMUST00000091246
SMART Domains Protein: ENSMUSP00000091696
Gene: ENSMUSG00000032633

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 103 267 3.5e-59 PFAM
low complexity region 293 308 N/A INTRINSIC
PDB:3V42|B 342 566 1e-144 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000102697
SMART Domains Protein: ENSMUSP00000099758
Gene: ENSMUSG00000032633

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 104 265 1.5e-55 PFAM
low complexity region 293 308 N/A INTRINSIC
Pfam:Folliculin_C 344 566 8.4e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148151
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two different knock-out alleles exhibit prenatal lethality. Mice homozygous for a gene-trapped allele show prenatal lethality while a fraction of heterozygotes develop spontaneous oncocytic renal cysts and solid renal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cwc27 T A 13: 104,631,616 E457V unknown Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Flcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Flcn APN 11 59795823 missense probably damaging 1.00
IGL01890:Flcn APN 11 59795170 missense probably benign 0.00
IGL02486:Flcn APN 11 59801043 nonsense probably null
IGL02933:Flcn APN 11 59803757 missense probably damaging 1.00
IGL02935:Flcn APN 11 59795236 missense possibly damaging 0.93
IGL03246:Flcn APN 11 59794110 missense possibly damaging 0.82
pansy UTSW 11 59792659 missense probably damaging 0.99
R0238:Flcn UTSW 11 59801076 missense probably benign 0.00
R0238:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0265:Flcn UTSW 11 59795809 nonsense probably null
R0551:Flcn UTSW 11 59795748 critical splice donor site probably null
R1016:Flcn UTSW 11 59795865 critical splice acceptor site probably null
R1108:Flcn UTSW 11 59801200 missense possibly damaging 0.77
R2350:Flcn UTSW 11 59792659 missense probably damaging 0.99
R4158:Flcn UTSW 11 59801121 missense probably benign 0.26
R4367:Flcn UTSW 11 59803784 missense possibly damaging 0.90
R4371:Flcn UTSW 11 59803784 missense possibly damaging 0.90
R4612:Flcn UTSW 11 59792687 missense probably damaging 1.00
R4689:Flcn UTSW 11 59801044 missense possibly damaging 0.87
R5849:Flcn UTSW 11 59804760 missense probably damaging 0.99
R6007:Flcn UTSW 11 59792622 missense probably benign 0.08
R6433:Flcn UTSW 11 59801082 missense probably damaging 0.97
R6525:Flcn UTSW 11 59794172 missense possibly damaging 0.75
R7027:Flcn UTSW 11 59795806 missense probably damaging 1.00
R7632:Flcn UTSW 11 59795799 nonsense probably null
R8018:Flcn UTSW 11 59794122 missense probably damaging 0.97
X0002:Flcn UTSW 11 59804537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAAGCCACAGAGAGCTGCTCTAC -3'
(R):5'- GCAGTGCAGTCAAGGGTCACTTTAC -3'

Sequencing Primer
(F):5'- GAGAGCTGCTCTACCCCTTG -3'
(R):5'- GCCACAGAGTTCGTAGTTGTC -3'
Posted On2013-06-12