Mutagenetix > Incidental Mutation

Incidental Mutation 'R0534:Psmc1'

49382

Institutional Source

Beutler Lab

Gene Symbol

Psmc1

Ensembl Gene

ENSMUSG00000021178

Gene Name

protease (prosome, macropain) 26S subunit, ATPase 1

Synonyms

S4, Rpt2/S4, rpt2, P26s4

MMRRC Submission

038726-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0534 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

100110154-100123405 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 100120130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 342 (I342N)

Ref Sequence

ENSEMBL: ENSMUSP00000021595 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021595]

AlphaFold

P62192

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021595
AA Change: I342N

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000021595
Gene: ENSMUSG00000021178
AA Change: I342N

Domain	Start	End	E-Value	Type
low complexity region	7	24	N/A	INTRINSIC
low complexity region	27	43	N/A	INTRINSIC
AAA	218	357	1.57e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221308

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222374

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223078

Meta Mutation Damage Score

0.9247

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.8%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal. Conditional null in cortical neurons causes neurodegeneration and premature death in several different models. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	T	C	10: 116,112,802	E273G	possibly damaging	Het
4933425L06Rik	C	A	13: 105,082,254	S32*	probably null	Het
Cand2	A	G	6: 115,787,236	M324V	probably damaging	Het
Cap1	C	T	4: 122,862,719	V340M	probably benign	Het
Ccdc110	T	C	8: 45,935,138	V44A	possibly damaging	Het
Cps1	A	G	1: 67,143,900	D139G	probably benign	Het
Cwc27	T	A	13: 104,631,616	E457V	unknown	Het
Cxxc1	C	T	18: 74,218,891	P280S	probably benign	Het
Dopey2	T	A	16: 93,762,505	L595Q	probably benign	Het
Dscam	G	T	16: 96,652,172	S1292R	possibly damaging	Het
E2f4	C	A	8: 105,304,219	F353L	probably damaging	Het
Ep300	A	G	15: 81,600,896		probably benign	Het
Fads1	C	T	19: 10,183,065	P5L	probably benign	Het
Fign	T	A	2: 63,980,791	H45L	probably damaging	Het
Flcn	T	A	11: 59,794,199		probably benign	Het
Gm5141	A	T	13: 62,774,594	F254I	probably damaging	Het
Gpbp1l1	T	A	4: 116,591,268	N402K	probably damaging	Het
Gpr37	A	T	6: 25,669,824	C340*	probably null	Het
Gtf3c2	A	T	5: 31,158,132		probably benign	Het
Hcfc2	T	A	10: 82,738,408	F139I	probably damaging	Het
Hectd4	T	C	5: 121,348,476	L3178P	possibly damaging	Het
Hrc	AGAGGAGGAGGAAGAGGAGGAGGA	AGAGGAGGAGGAGGAAGAGGAGGAGGA	7: 45,337,235		probably benign	Het
Igf2bp1	A	G	11: 95,966,796		probably benign	Het
Igsf9b	T	G	9: 27,333,062		probably null	Het
Il23r	G	A	6: 67,426,588	A443V	probably benign	Het
Kcnv1	A	G	15: 45,109,249	F413L	probably damaging	Het
Lipe	C	A	7: 25,388,186	A150S	possibly damaging	Het
Lrrcc1	T	C	3: 14,557,273	S557P	probably damaging	Het
Mrpl54	C	A	10: 81,266,853	W13L	probably damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Npy1r	C	A	8: 66,705,018	Q327K	probably damaging	Het
Olfr64	C	T	7: 103,893,231	R168H	probably benign	Het
Osbpl10	C	T	9: 115,167,178	L139F	probably damaging	Het
P2rx6	A	C	16: 17,567,904	T199P	probably damaging	Het
Phyhip	A	T	14: 70,461,759	M1L	possibly damaging	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Reln	A	T	5: 21,947,408	D2353E	probably damaging	Het
Rmdn3	T	C	2: 119,146,370	E294G	probably benign	Het
Scnn1g	A	G	7: 121,767,424	M615V	probably benign	Het
Shcbp1l	T	A	1: 153,428,568	D124E	possibly damaging	Het
Sipa1l1	T	C	12: 82,425,280	S1345P	possibly damaging	Het
Soga3	T	A	10: 29,180,956		probably benign	Het
St5	A	T	7: 109,541,428	V197D	probably damaging	Het
Timp4	A	G	6: 115,249,841	Y114H	probably damaging	Het
Tlr9	T	A	9: 106,224,887	L459Q	probably benign	Het
Tmem104	C	A	11: 115,200,828	T59K	probably damaging	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Zfp622	A	T	15: 25,984,568	I7F	possibly damaging	Het

Other mutations in Psmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01700:Psmc1	APN	12	100113078	missense	probably damaging	1.00
IGL02445:Psmc1	APN	12	100114828	splice site	probably benign
IGL02605:Psmc1	APN	12	100119127	missense	probably damaging	1.00
R0018:Psmc1	UTSW	12	100116692	splice site	probably benign
R0018:Psmc1	UTSW	12	100116692	splice site	probably benign
R0427:Psmc1	UTSW	12	100119228	missense	probably damaging	0.96
R0931:Psmc1	UTSW	12	100119082	missense	probably damaging	0.99
R1937:Psmc1	UTSW	12	100114843	missense	probably benign	0.26
R2405:Psmc1	UTSW	12	100120103	missense	probably benign	0.03
R5063:Psmc1	UTSW	12	100115475	missense	probably damaging	0.97
R5293:Psmc1	UTSW	12	100115472	missense	probably benign	0.11
R5346:Psmc1	UTSW	12	100120100	missense	probably damaging	0.99
R5542:Psmc1	UTSW	12	100120140	critical splice donor site	probably null
R7513:Psmc1	UTSW	12	100115514	missense	probably benign	0.19
R7993:Psmc1	UTSW	12	100115565	missense	probably benign	0.01
R8489:Psmc1	UTSW	12	100123097	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTCCTTTCAACAGAACGACTGGG -3'
(R):5'- TAGGGAGACAGCCTTGAACTCCTC -3'

Sequencing Primer
(F):5'- TTCAACAGAACGACTGGGTCTTC -3'
(R):5'- tgtggaggtgtgggtgg -3'

Posted On

2013-06-12