Incidental Mutation 'R0534:Cwc27'
ID49384
Institutional Source Beutler Lab
Gene Symbol Cwc27
Ensembl Gene ENSMUSG00000021715
Gene NameCWC27 spliceosome-associated protein
Synonyms3110009E13Rik, NY-CO-10, Sdccag10
MMRRC Submission 038726-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0534 (G1)
Quality Score217
Status Validated
Chromosome13
Chromosomal Location104631140-104817142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104631616 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 457 (E457V)
Ref Sequence ENSEMBL: ENSMUSP00000022228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022228]
Predicted Effect unknown
Transcript: ENSMUST00000022228
AA Change: E457V
SMART Domains Protein: ENSMUSP00000022228
Gene: ENSMUSG00000021715
AA Change: E457V

DomainStartEndE-ValueType
Pfam:Pro_isomerase 14 166 3.4e-47 PFAM
low complexity region 176 197 N/A INTRINSIC
low complexity region 209 217 N/A INTRINSIC
coiled coil region 309 341 N/A INTRINSIC
low complexity region 452 469 N/A INTRINSIC
Meta Mutation Damage Score 0.1887 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit reduced viability. Surviors after birth show signs of growth retardation and retinal depigmentation, along with numerous neurological, immunological, and blood chemistry abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik T C 10: 116,112,802 E273G possibly damaging Het
4933425L06Rik C A 13: 105,082,254 S32* probably null Het
Cand2 A G 6: 115,787,236 M324V probably damaging Het
Cap1 C T 4: 122,862,719 V340M probably benign Het
Ccdc110 T C 8: 45,935,138 V44A possibly damaging Het
Cps1 A G 1: 67,143,900 D139G probably benign Het
Cxxc1 C T 18: 74,218,891 P280S probably benign Het
Dopey2 T A 16: 93,762,505 L595Q probably benign Het
Dscam G T 16: 96,652,172 S1292R possibly damaging Het
E2f4 C A 8: 105,304,219 F353L probably damaging Het
Ep300 A G 15: 81,600,896 probably benign Het
Fads1 C T 19: 10,183,065 P5L probably benign Het
Fign T A 2: 63,980,791 H45L probably damaging Het
Flcn T A 11: 59,794,199 probably benign Het
Gm5141 A T 13: 62,774,594 F254I probably damaging Het
Gpbp1l1 T A 4: 116,591,268 N402K probably damaging Het
Gpr37 A T 6: 25,669,824 C340* probably null Het
Gtf3c2 A T 5: 31,158,132 probably benign Het
Hcfc2 T A 10: 82,738,408 F139I probably damaging Het
Hectd4 T C 5: 121,348,476 L3178P possibly damaging Het
Hrc AGAGGAGGAGGAAGAGGAGGAGGA AGAGGAGGAGGAGGAAGAGGAGGAGGA 7: 45,337,235 probably benign Het
Igf2bp1 A G 11: 95,966,796 probably benign Het
Igsf9b T G 9: 27,333,062 probably null Het
Il23r G A 6: 67,426,588 A443V probably benign Het
Kcnv1 A G 15: 45,109,249 F413L probably damaging Het
Lipe C A 7: 25,388,186 A150S possibly damaging Het
Lrrcc1 T C 3: 14,557,273 S557P probably damaging Het
Mrpl54 C A 10: 81,266,853 W13L probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Npy1r C A 8: 66,705,018 Q327K probably damaging Het
Olfr64 C T 7: 103,893,231 R168H probably benign Het
Osbpl10 C T 9: 115,167,178 L139F probably damaging Het
P2rx6 A C 16: 17,567,904 T199P probably damaging Het
Phyhip A T 14: 70,461,759 M1L possibly damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Psmc1 T A 12: 100,120,130 I342N possibly damaging Het
Reln A T 5: 21,947,408 D2353E probably damaging Het
Rmdn3 T C 2: 119,146,370 E294G probably benign Het
Scnn1g A G 7: 121,767,424 M615V probably benign Het
Shcbp1l T A 1: 153,428,568 D124E possibly damaging Het
Sipa1l1 T C 12: 82,425,280 S1345P possibly damaging Het
Soga3 T A 10: 29,180,956 probably benign Het
St5 A T 7: 109,541,428 V197D probably damaging Het
Timp4 A G 6: 115,249,841 Y114H probably damaging Het
Tlr9 T A 9: 106,224,887 L459Q probably benign Het
Tmem104 C A 11: 115,200,828 T59K probably damaging Het
Wdr59 GGGTGGTG GGGTG 8: 111,480,540 probably benign Het
Zfp622 A T 15: 25,984,568 I7F possibly damaging Het
Other mutations in Cwc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01955:Cwc27 APN 13 104807737 missense probably damaging 1.00
IGL02240:Cwc27 APN 13 104806643 missense probably damaging 0.97
IGL02398:Cwc27 APN 13 104804254 missense possibly damaging 0.82
IGL02620:Cwc27 APN 13 104802206 splice site probably benign
IGL03213:Cwc27 APN 13 104796403 splice site probably benign
pam1 UTSW 13 104661357 nonsense probably null
R0375:Cwc27 UTSW 13 104807823 missense possibly damaging 0.94
R0483:Cwc27 UTSW 13 104811216 critical splice donor site probably null
R0550:Cwc27 UTSW 13 104804949 missense probably damaging 1.00
R0562:Cwc27 UTSW 13 104661357 nonsense probably null
R0563:Cwc27 UTSW 13 104661357 nonsense probably null
R0564:Cwc27 UTSW 13 104661357 nonsense probably null
R0972:Cwc27 UTSW 13 104661357 nonsense probably null
R1536:Cwc27 UTSW 13 104797306 missense probably damaging 1.00
R1546:Cwc27 UTSW 13 104802185 missense probably damaging 1.00
R1587:Cwc27 UTSW 13 104792637 missense probably benign 0.00
R1934:Cwc27 UTSW 13 104631676 missense probably benign 0.28
R2159:Cwc27 UTSW 13 104804329 missense probably damaging 0.98
R2249:Cwc27 UTSW 13 104631622 missense unknown
R2252:Cwc27 UTSW 13 104631729 missense probably damaging 1.00
R2394:Cwc27 UTSW 13 104796434 missense probably benign 0.01
R2698:Cwc27 UTSW 13 104806751 missense probably damaging 0.99
R3899:Cwc27 UTSW 13 104792515 nonsense probably null
R5121:Cwc27 UTSW 13 104804353 missense probably damaging 1.00
R6317:Cwc27 UTSW 13 104804261 nonsense probably null
R6763:Cwc27 UTSW 13 104811301 missense probably damaging 1.00
R7187:Cwc27 UTSW 13 104661392 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAACACAGGCTCTGACAGCCTTC -3'
(R):5'- AAGACTTTGCTAGGCCAGCTCTGC -3'

Sequencing Primer
(F):5'- TGACAGCCTTCCCACCG -3'
(R):5'- TCTGTGGGACTGCTCTCCAG -3'
Posted On2013-06-12