Incidental Mutation 'R0535:Kel'
ID49410
Institutional Source Beutler Lab
Gene Symbol Kel
Ensembl Gene ENSMUSG00000029866
Gene NameKell blood group
SynonymsCD238
MMRRC Submission 038727-MU
Accession Numbers

Genbank: NM_032540; MGI: 1346053

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0535 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41686330-41704339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41690838 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 390 (K390R)
Ref Sequence ENSEMBL: ENSMUSP00000031899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031899] [ENSMUST00000194597]
Predicted Effect probably null
Transcript: ENSMUST00000031899
AA Change: K390R

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031899
Gene: ENSMUSG00000029866
AA Change: K390R

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Peptidase_M13_N 81 463 1.5e-68 PFAM
Pfam:Peptidase_M13 521 712 2.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153760
Predicted Effect probably null
Transcript: ENSMUST00000192118
AA Change: K72R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192406
Predicted Effect probably benign
Transcript: ENSMUST00000194597
SMART Domains Protein: ENSMUSP00000142058
Gene: ENSMUSG00000029866

DomainStartEndE-ValueType
Pfam:Peptidase_M13 16 68 3.6e-10 PFAM
Meta Mutation Damage Score 0.1631 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II transmembrane glycoprotein that is the highly polymorphic Kell blood group antigen. The Kell glycoprotein links via a single disulfide bond to the XK membrane protein that carries the Kx antigen. The encoded protein contains sequence and structural similarity to members of the neprilysin (M13) family of zinc endopeptidases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased heart rate, altered hematological parameters and ECG waveform features, decreased erythrocyte Mg2+ and K+ ion content, mild motor deficits, and giant axon changes with varying degrees of paranodal demyelination in the spinal cord and sciatic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,748,181 F118S possibly damaging Het
Aatk A G 11: 120,010,193 S1069P probably benign Het
Acmsd A T 1: 127,765,943 I305L probably benign Het
Aco2 G A 15: 81,913,217 E625K possibly damaging Het
Acox1 G A 11: 116,174,438 T561I possibly damaging Het
Acox2 T A 14: 8,256,753 T37S probably damaging Het
Apc A T 18: 34,261,072 K17M probably damaging Het
BC027072 A G 17: 71,752,439 V81A probably benign Het
Cant1 T C 11: 118,411,143 D116G probably damaging Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Cyp51 T C 5: 4,099,202 Q225R probably benign Het
E2f8 T C 7: 48,871,810 probably benign Het
Fam163b T C 2: 27,112,766 Y73C probably benign Het
Fbxw9 T C 8: 85,064,600 C271R probably damaging Het
Gbp10 T C 5: 105,221,011 N321D possibly damaging Het
Gle1 T C 2: 29,957,805 F675L probably damaging Het
Gm6327 T C 16: 12,760,377 noncoding transcript Het
Gphn T A 12: 78,492,050 F157I possibly damaging Het
Gtpbp1 A T 15: 79,707,732 T94S probably damaging Het
Hdac2 T C 10: 36,993,899 F286L probably benign Het
Ighv3-6 A T 12: 114,288,470 probably benign Het
Itga2b A G 11: 102,457,533 V791A possibly damaging Het
Itgb4 A T 11: 115,991,009 I796F possibly damaging Het
Krt42 C T 11: 100,264,586 C368Y probably damaging Het
Lancl1 A G 1: 67,009,906 probably benign Het
Lipg A G 18: 74,954,220 Y177H probably damaging Het
Lnpep T C 17: 17,571,673 E402G possibly damaging Het
Ltbp2 A T 12: 84,784,858 I1727N probably damaging Het
Ltbp2 A G 12: 84,791,052 F1185L probably damaging Het
Mettl22 T C 16: 8,484,346 probably benign Het
Mug1 G A 6: 121,851,454 G275E probably benign Het
Nell2 T A 15: 95,431,607 T278S probably benign Het
Nomo1 T A 7: 46,072,517 S961T probably damaging Het
Olfr992 A G 2: 85,400,095 L146P possibly damaging Het
Phf2 A G 13: 48,813,947 Y675H unknown Het
Phldb2 A G 16: 45,757,127 V1145A probably damaging Het
Phrf1 T C 7: 141,260,065 S1058P probably benign Het
Prss3 T C 6: 41,374,969 N120S probably benign Het
Reln G T 5: 22,051,276 probably benign Het
Soga1 T C 2: 157,033,289 E847G possibly damaging Het
Spag5 A G 11: 78,304,728 Y287C probably benign Het
Syde2 G A 3: 145,989,170 probably null Het
Synj1 C A 16: 90,948,087 V1190F possibly damaging Het
Taok1 A T 11: 77,553,704 I515N probably benign Het
Tmem259 A T 10: 79,978,595 V309E probably damaging Het
Tmem62 T A 2: 121,002,596 V494E possibly damaging Het
Trak1 A T 9: 121,443,712 E119V probably null Het
Vmn1r1 T A 1: 182,157,951 I50L probably benign Het
Xpc C T 6: 91,504,578 V254I possibly damaging Het
Zfp58 G A 13: 67,492,082 Q97* probably null Het
Zscan5b A G 7: 6,233,912 E220G possibly damaging Het
Other mutations in Kel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Kel APN 6 41688575 missense probably damaging 1.00
IGL00792:Kel APN 6 41702012 missense probably damaging 1.00
IGL00972:Kel APN 6 41688066 missense possibly damaging 0.62
IGL01121:Kel APN 6 41702409 missense probably benign 0.00
IGL01286:Kel APN 6 41688117 splice site probably null
IGL01461:Kel APN 6 41701911 critical splice donor site probably null
IGL01836:Kel APN 6 41697438 missense possibly damaging 0.50
IGL02037:Kel APN 6 41697474 missense probably benign 0.01
IGL02103:Kel APN 6 41702389 missense probably benign 0.18
IGL02604:Kel APN 6 41687582 missense probably damaging 0.98
IGL03102:Kel APN 6 41702983 missense probably benign 0.00
IGL03274:Kel APN 6 41687995 unclassified probably null
IGL03355:Kel APN 6 41698887 critical splice donor site probably null
A4554:Kel UTSW 6 41697419 missense possibly damaging 0.95
R0121:Kel UTSW 6 41702064 unclassified probably benign
R0153:Kel UTSW 6 41701943 missense probably benign 0.08
R0658:Kel UTSW 6 41703031 missense probably damaging 1.00
R1005:Kel UTSW 6 41688617 missense probably damaging 1.00
R1199:Kel UTSW 6 41688591 missense possibly damaging 0.95
R1272:Kel UTSW 6 41703470 missense probably benign 0.00
R1531:Kel UTSW 6 41688626 missense probably damaging 0.99
R1880:Kel UTSW 6 41687545 missense possibly damaging 0.95
R2102:Kel UTSW 6 41686484 missense possibly damaging 0.86
R2118:Kel UTSW 6 41689300 missense probably benign
R2571:Kel UTSW 6 41688067 missense possibly damaging 0.62
R4209:Kel UTSW 6 41698425 nonsense probably null
R4210:Kel UTSW 6 41698425 nonsense probably null
R4260:Kel UTSW 6 41686423 utr 3 prime probably benign
R4382:Kel UTSW 6 41698400 missense probably benign 0.13
R5023:Kel UTSW 6 41688111 missense probably damaging 1.00
R5033:Kel UTSW 6 41699055 missense probably damaging 1.00
R5239:Kel UTSW 6 41688114 nonsense probably null
R5431:Kel UTSW 6 41698420 missense probably benign 0.23
R5742:Kel UTSW 6 41699027 missense probably damaging 1.00
R5745:Kel UTSW 6 41699027 missense probably damaging 1.00
R5746:Kel UTSW 6 41699027 missense probably damaging 1.00
R5978:Kel UTSW 6 41688045 missense probably benign 0.00
R6023:Kel UTSW 6 41697475 missense probably benign
R6109:Kel UTSW 6 41688862 missense probably benign 0.06
R6125:Kel UTSW 6 41690786 missense probably damaging 1.00
R6319:Kel UTSW 6 41702447 missense probably benign 0.05
R6368:Kel UTSW 6 41688851 nonsense probably null
R6864:Kel UTSW 6 41703760 critical splice donor site probably null
R6956:Kel UTSW 6 41687973 missense probably damaging 1.00
R7644:Kel UTSW 6 41690808 missense probably benign 0.03
X0028:Kel UTSW 6 41698351 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCACAGAATAGGGCAAGGTGTATTGG -3'
(R):5'- AGAAGGGAAGCCTCTTTCTACTGAGC -3'

Sequencing Primer
(F):5'- GCAAGGTGTATTGGGTGGAAAG -3'
(R):5'- atctgtctttttatcactcttcacc -3'
Posted On2013-06-12