Incidental Mutation 'R0535:Zscan5b'
ID 49413
Institutional Source Beutler Lab
Gene Symbol Zscan5b
Ensembl Gene ENSMUSG00000058028
Gene Name zinc finger and SCAN domain containing 5B
Synonyms Zfp371, Zfg1
MMRRC Submission 038727-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0535 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 6225277-6242416 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6236911 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 220 (E220G)
Ref Sequence ENSEMBL: ENSMUSP00000126044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072662] [ENSMUST00000155314] [ENSMUST00000165445]
AlphaFold B2RTN3
Predicted Effect possibly damaging
Transcript: ENSMUST00000072662
AA Change: E220G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072449
Gene: ENSMUSG00000058028
AA Change: E220G

DomainStartEndE-ValueType
Pfam:SCAN 31 121 1.6e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155314
SMART Domains Protein: ENSMUSP00000118508
Gene: ENSMUSG00000058028

DomainStartEndE-ValueType
Pfam:SCAN 31 121 4.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165445
AA Change: E220G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126044
Gene: ENSMUSG00000058028
AA Change: E220G

DomainStartEndE-ValueType
Pfam:SCAN 33 120 1e-25 PFAM
low complexity region 157 166 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
ZnF_C2H2 326 348 3.11e-2 SMART
ZnF_C2H2 354 376 1.28e-3 SMART
ZnF_C2H2 382 404 1.36e-2 SMART
ZnF_C2H2 410 432 3.16e-3 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 119,901,019 (GRCm39) S1069P probably benign Het
Acmsd A T 1: 127,693,680 (GRCm39) I305L probably benign Het
Aco2 G A 15: 81,797,418 (GRCm39) E625K possibly damaging Het
Acox1 G A 11: 116,065,264 (GRCm39) T561I possibly damaging Het
Acox2 T A 14: 8,256,753 (GRCm38) T37S probably damaging Het
Apc A T 18: 34,394,125 (GRCm39) K17M probably damaging Het
Cant1 T C 11: 118,301,969 (GRCm39) D116G probably damaging Het
Col11a1 A G 3: 113,855,184 (GRCm39) E148G unknown Het
Cyp51 T C 5: 4,149,202 (GRCm39) Q225R probably benign Het
E2f8 T C 7: 48,521,558 (GRCm39) probably benign Het
Fam163b T C 2: 27,002,778 (GRCm39) Y73C probably benign Het
Fbxw9 T C 8: 85,791,229 (GRCm39) C271R probably damaging Het
Gbp10 T C 5: 105,368,877 (GRCm39) N321D possibly damaging Het
Gle1 T C 2: 29,847,817 (GRCm39) F675L probably damaging Het
Gm6327 T C 16: 12,578,241 (GRCm39) noncoding transcript Het
Gphn T A 12: 78,538,824 (GRCm39) F157I possibly damaging Het
Gtpbp1 A T 15: 79,591,933 (GRCm39) T94S probably damaging Het
Hdac2 T C 10: 36,869,895 (GRCm39) F286L probably benign Het
Ighv3-6 A T 12: 114,252,090 (GRCm39) probably benign Het
Itga2b A G 11: 102,348,359 (GRCm39) V791A possibly damaging Het
Itgb4 A T 11: 115,881,835 (GRCm39) I796F possibly damaging Het
Kel T C 6: 41,667,772 (GRCm39) K390R probably null Het
Krt42 C T 11: 100,155,412 (GRCm39) C368Y probably damaging Het
Lancl1 A G 1: 67,049,065 (GRCm39) probably benign Het
Lipg A G 18: 75,087,291 (GRCm39) Y177H probably damaging Het
Lnpep T C 17: 17,791,935 (GRCm39) E402G possibly damaging Het
Ltbp2 A G 12: 84,837,826 (GRCm39) F1185L probably damaging Het
Ltbp2 A T 12: 84,831,632 (GRCm39) I1727N probably damaging Het
Mettl22 T C 16: 8,302,210 (GRCm39) probably benign Het
Mtcl2 T C 2: 156,875,209 (GRCm39) E847G possibly damaging Het
Mug1 G A 6: 121,828,413 (GRCm39) G275E probably benign Het
Nell2 T A 15: 95,329,488 (GRCm39) T278S probably benign Het
Nomo1 T A 7: 45,721,941 (GRCm39) S961T probably damaging Het
Or5ak22 A G 2: 85,230,439 (GRCm39) L146P possibly damaging Het
Pcare A G 17: 72,059,434 (GRCm39) V81A probably benign Het
Phf2 A G 13: 48,967,423 (GRCm39) Y675H unknown Het
Phldb2 A G 16: 45,577,490 (GRCm39) V1145A probably damaging Het
Phrf1 T C 7: 140,839,978 (GRCm39) S1058P probably benign Het
Prss3 T C 6: 41,351,903 (GRCm39) N120S probably benign Het
Reln G T 5: 22,256,274 (GRCm39) probably benign Het
Spag5 A G 11: 78,195,554 (GRCm39) Y287C probably benign Het
Syde2 G A 3: 145,694,925 (GRCm39) probably null Het
Synj1 C A 16: 90,744,975 (GRCm39) V1190F possibly damaging Het
Taok1 A T 11: 77,444,530 (GRCm39) I515N probably benign Het
Tmem259 A T 10: 79,814,429 (GRCm39) V309E probably damaging Het
Tmem62 T A 2: 120,833,077 (GRCm39) V494E possibly damaging Het
Trak1 A T 9: 121,272,778 (GRCm39) E119V probably null Het
Vmn1r1 T A 1: 181,985,516 (GRCm39) I50L probably benign Het
Vps35l T C 7: 118,347,404 (GRCm39) F118S possibly damaging Het
Xpc C T 6: 91,481,560 (GRCm39) V254I possibly damaging Het
Zfp58 G A 13: 67,640,201 (GRCm39) Q97* probably null Het
Other mutations in Zscan5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Zscan5b APN 7 6,234,421 (GRCm39) missense probably benign 0.00
R0505:Zscan5b UTSW 7 6,242,074 (GRCm39) missense probably damaging 0.99
R1401:Zscan5b UTSW 7 6,233,425 (GRCm39) missense probably damaging 1.00
R1537:Zscan5b UTSW 7 6,236,850 (GRCm39) missense probably benign 0.00
R1613:Zscan5b UTSW 7 6,233,374 (GRCm39) missense probably damaging 1.00
R1820:Zscan5b UTSW 7 6,242,162 (GRCm39) missense probably damaging 1.00
R1833:Zscan5b UTSW 7 6,241,965 (GRCm39) missense possibly damaging 0.67
R2191:Zscan5b UTSW 7 6,234,442 (GRCm39) missense possibly damaging 0.53
R3177:Zscan5b UTSW 7 6,234,345 (GRCm39) missense possibly damaging 0.86
R3277:Zscan5b UTSW 7 6,234,345 (GRCm39) missense possibly damaging 0.86
R4911:Zscan5b UTSW 7 6,242,189 (GRCm39) makesense probably null
R5624:Zscan5b UTSW 7 6,233,518 (GRCm39) missense probably benign 0.00
R8213:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8214:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8326:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8327:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8328:Zscan5b UTSW 7 6,236,946 (GRCm39) missense possibly damaging 0.93
R8985:Zscan5b UTSW 7 6,241,834 (GRCm39) missense probably damaging 0.99
R9474:Zscan5b UTSW 7 6,234,472 (GRCm39) missense probably benign 0.00
R9717:Zscan5b UTSW 7 6,234,525 (GRCm39) missense possibly damaging 0.73
X0018:Zscan5b UTSW 7 6,233,275 (GRCm39) missense probably damaging 0.97
X0024:Zscan5b UTSW 7 6,241,948 (GRCm39) missense probably benign 0.00
X0025:Zscan5b UTSW 7 6,241,614 (GRCm39) missense probably benign 0.18
Z1177:Zscan5b UTSW 7 6,233,216 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTGGGATAATAGGGTGGGCTCTAGAA -3'
(R):5'- CAACTCTGGTGTTGGCTGGGAA -3'

Sequencing Primer
(F):5'- AAGTGAGTGTAGTGCGCC -3'
(R):5'- TGTTGGCTGGGAACATCC -3'
Posted On 2013-06-12