Incidental Mutation 'R0535:Acox1'
ID49427
Institutional Source Beutler Lab
Gene Symbol Acox1
Ensembl Gene ENSMUSG00000020777
Gene Nameacyl-Coenzyme A oxidase 1, palmitoyl
SynonymsAOX, Acyl-CoA oxidase, D130055E20Rik
MMRRC Submission 038727-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R0535 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116171888-116199045 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116174438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 561 (T561I)
Ref Sequence ENSEMBL: ENSMUSP00000122185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066587] [ENSMUST00000072948] [ENSMUST00000148601]
Predicted Effect probably benign
Transcript: ENSMUST00000066587
AA Change: T597I

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000063325
Gene: ENSMUSG00000020777
AA Change: T597I

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 15 133 4.4e-39 PFAM
Pfam:Acyl-CoA_dh_M 135 245 3e-13 PFAM
SCOP:d1is2a1 272 460 1e-43 SMART
Pfam:ACOX 479 659 6.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072948
AA Change: T597I

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072717
Gene: ENSMUSG00000020777
AA Change: T597I

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 15 133 6.8e-38 PFAM
Pfam:Acyl-CoA_dh_M 135 195 1.3e-8 PFAM
SCOP:d1is2a1 272 460 9e-44 SMART
Pfam:ACOX 476 661 4.4e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130229
Predicted Effect possibly damaging
Transcript: ENSMUST00000148601
AA Change: T561I

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122185
Gene: ENSMUSG00000020777
AA Change: T561I

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 48 97 9.7e-15 PFAM
Pfam:Acyl-CoA_dh_M 99 159 7.3e-9 PFAM
SCOP:d1is2a1 236 424 4e-44 SMART
Pfam:ACOX 440 625 1.7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150549
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a member of the acyl-coenzyme A oxidase family. The encoded protein is localized to peroxisomes and is the first enzyme of the fatty acid beta-oxidation pathway, which catalyzes the desaturation of acyl-coenzyme A to 2-trans-enoyl-coenzyme A. Disruption of this gene results in microvesicular steatohepatitis, spontaneous peroxisome proliferation, and the eventual development of hepatocellular carcinomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a targeted mutation that inactivates the gene show growth retardation, infertility, excess very long chain fatty acids in the blood, and progressive liver disease, including hepatomegaly, and hepatic adenomas and carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,748,181 F118S possibly damaging Het
Aatk A G 11: 120,010,193 S1069P probably benign Het
Acmsd A T 1: 127,765,943 I305L probably benign Het
Aco2 G A 15: 81,913,217 E625K possibly damaging Het
Acox2 T A 14: 8,256,753 T37S probably damaging Het
Apc A T 18: 34,261,072 K17M probably damaging Het
BC027072 A G 17: 71,752,439 V81A probably benign Het
Cant1 T C 11: 118,411,143 D116G probably damaging Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Cyp51 T C 5: 4,099,202 Q225R probably benign Het
E2f8 T C 7: 48,871,810 probably benign Het
Fam163b T C 2: 27,112,766 Y73C probably benign Het
Fbxw9 T C 8: 85,064,600 C271R probably damaging Het
Gbp10 T C 5: 105,221,011 N321D possibly damaging Het
Gle1 T C 2: 29,957,805 F675L probably damaging Het
Gm6327 T C 16: 12,760,377 noncoding transcript Het
Gphn T A 12: 78,492,050 F157I possibly damaging Het
Gtpbp1 A T 15: 79,707,732 T94S probably damaging Het
Hdac2 T C 10: 36,993,899 F286L probably benign Het
Ighv3-6 A T 12: 114,288,470 probably benign Het
Itga2b A G 11: 102,457,533 V791A possibly damaging Het
Itgb4 A T 11: 115,991,009 I796F possibly damaging Het
Kel T C 6: 41,690,838 K390R probably null Het
Krt42 C T 11: 100,264,586 C368Y probably damaging Het
Lancl1 A G 1: 67,009,906 probably benign Het
Lipg A G 18: 74,954,220 Y177H probably damaging Het
Lnpep T C 17: 17,571,673 E402G possibly damaging Het
Ltbp2 A T 12: 84,784,858 I1727N probably damaging Het
Ltbp2 A G 12: 84,791,052 F1185L probably damaging Het
Mettl22 T C 16: 8,484,346 probably benign Het
Mug1 G A 6: 121,851,454 G275E probably benign Het
Nell2 T A 15: 95,431,607 T278S probably benign Het
Nomo1 T A 7: 46,072,517 S961T probably damaging Het
Olfr992 A G 2: 85,400,095 L146P possibly damaging Het
Phf2 A G 13: 48,813,947 Y675H unknown Het
Phldb2 A G 16: 45,757,127 V1145A probably damaging Het
Phrf1 T C 7: 141,260,065 S1058P probably benign Het
Prss3 T C 6: 41,374,969 N120S probably benign Het
Reln G T 5: 22,051,276 probably benign Het
Soga1 T C 2: 157,033,289 E847G possibly damaging Het
Spag5 A G 11: 78,304,728 Y287C probably benign Het
Syde2 G A 3: 145,989,170 probably null Het
Synj1 C A 16: 90,948,087 V1190F possibly damaging Het
Taok1 A T 11: 77,553,704 I515N probably benign Het
Tmem259 A T 10: 79,978,595 V309E probably damaging Het
Tmem62 T A 2: 121,002,596 V494E possibly damaging Het
Trak1 A T 9: 121,443,712 E119V probably null Het
Vmn1r1 T A 1: 182,157,951 I50L probably benign Het
Xpc C T 6: 91,504,578 V254I possibly damaging Het
Zfp58 G A 13: 67,492,082 Q97* probably null Het
Zscan5b A G 7: 6,233,912 E220G possibly damaging Het
Other mutations in Acox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Acox1 APN 11 116174505 splice site probably benign
IGL02096:Acox1 APN 11 116178198 missense probably damaging 0.99
IGL03128:Acox1 APN 11 116182003 missense probably damaging 1.00
R1718:Acox1 UTSW 11 116174682 nonsense probably null
R1728:Acox1 UTSW 11 116198283 unclassified probably null
R1971:Acox1 UTSW 11 116198261 missense probably benign 0.05
R3770:Acox1 UTSW 11 116174387 missense probably damaging 1.00
R4347:Acox1 UTSW 11 116198661 missense probably benign 0.03
R4836:Acox1 UTSW 11 116175326 missense probably benign 0.05
R5551:Acox1 UTSW 11 116189491 missense possibly damaging 0.73
R6662:Acox1 UTSW 11 116175323 missense probably damaging 1.00
R6685:Acox1 UTSW 11 116180348 nonsense probably null
R7453:Acox1 UTSW 11 116180961 missense probably benign 0.41
R7468:Acox1 UTSW 11 116178175 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACATCCCCGCACTGGAGTTATAGG -3'
(R):5'- TTCAAGACAGAGCCGTGCAAGC -3'

Sequencing Primer
(F):5'- ATAGGGAGTCCTGTGCCTAGC -3'
(R):5'- CTCTCTATGGGATCAGCCAGAAAG -3'
Posted On2013-06-12