Incidental Mutation 'R0535:Nell2'
ID49439
Institutional Source Beutler Lab
Gene Symbol Nell2
Ensembl Gene ENSMUSG00000022454
Gene NameNEL-like 2
SynonymsA330108N19Rik, mel91
MMRRC Submission 038727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0535 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location95075230-95528559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95431607 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 278 (T278S)
Ref Sequence ENSEMBL: ENSMUSP00000131665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075275] [ENSMUST00000166170] [ENSMUST00000229933] [ENSMUST00000229981]
Predicted Effect probably benign
Transcript: ENSMUST00000075275
AA Change: T278S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000074751
Gene: ENSMUSG00000022454
AA Change: T278S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166170
AA Change: T278S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131665
Gene: ENSMUSG00000022454
AA Change: T278S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
TSPN 32 217 9.94e-64 SMART
LamG 86 216 3.97e-8 SMART
coiled coil region 242 271 N/A INTRINSIC
VWC 277 333 6.18e-10 SMART
VWC 337 398 3.57e0 SMART
EGF 403 442 2.02e-1 SMART
EGF_CA 443 484 2.8e-9 SMART
EGF_CA 485 525 9.47e-7 SMART
EGF 527 556 1.28e-3 SMART
EGF_CA 558 604 2.13e-9 SMART
EGF_like 605 644 9.39e-4 SMART
VWC 643 695 8.88e-1 SMART
VWC 703 758 1.13e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229933
AA Change: T278S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000229981
AA Change: T278S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein containing several von Willebrand factor C domains and epidermal growth factor (EGF)-like domains. The encoded protein acts as a homotrimer and is found in the cytoplasm. Several variants encoding a few different isoforms exist, and at least one isoform appears to be a secreted protein. Studies in mouse suggest that this protein plays a role in neural cell growth and differentiation as well as in oncogenesis. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice display enhanced long term potentiation in the dentate gyrus of the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,748,181 F118S possibly damaging Het
Aatk A G 11: 120,010,193 S1069P probably benign Het
Acmsd A T 1: 127,765,943 I305L probably benign Het
Aco2 G A 15: 81,913,217 E625K possibly damaging Het
Acox1 G A 11: 116,174,438 T561I possibly damaging Het
Acox2 T A 14: 8,256,753 T37S probably damaging Het
Apc A T 18: 34,261,072 K17M probably damaging Het
BC027072 A G 17: 71,752,439 V81A probably benign Het
Cant1 T C 11: 118,411,143 D116G probably damaging Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Cyp51 T C 5: 4,099,202 Q225R probably benign Het
E2f8 T C 7: 48,871,810 probably benign Het
Fam163b T C 2: 27,112,766 Y73C probably benign Het
Fbxw9 T C 8: 85,064,600 C271R probably damaging Het
Gbp10 T C 5: 105,221,011 N321D possibly damaging Het
Gle1 T C 2: 29,957,805 F675L probably damaging Het
Gm6327 T C 16: 12,760,377 noncoding transcript Het
Gphn T A 12: 78,492,050 F157I possibly damaging Het
Gtpbp1 A T 15: 79,707,732 T94S probably damaging Het
Hdac2 T C 10: 36,993,899 F286L probably benign Het
Ighv3-6 A T 12: 114,288,470 probably benign Het
Itga2b A G 11: 102,457,533 V791A possibly damaging Het
Itgb4 A T 11: 115,991,009 I796F possibly damaging Het
Kel T C 6: 41,690,838 K390R probably null Het
Krt42 C T 11: 100,264,586 C368Y probably damaging Het
Lancl1 A G 1: 67,009,906 probably benign Het
Lipg A G 18: 74,954,220 Y177H probably damaging Het
Lnpep T C 17: 17,571,673 E402G possibly damaging Het
Ltbp2 A T 12: 84,784,858 I1727N probably damaging Het
Ltbp2 A G 12: 84,791,052 F1185L probably damaging Het
Mettl22 T C 16: 8,484,346 probably benign Het
Mug1 G A 6: 121,851,454 G275E probably benign Het
Nomo1 T A 7: 46,072,517 S961T probably damaging Het
Olfr992 A G 2: 85,400,095 L146P possibly damaging Het
Phf2 A G 13: 48,813,947 Y675H unknown Het
Phldb2 A G 16: 45,757,127 V1145A probably damaging Het
Phrf1 T C 7: 141,260,065 S1058P probably benign Het
Prss3 T C 6: 41,374,969 N120S probably benign Het
Reln G T 5: 22,051,276 probably benign Het
Soga1 T C 2: 157,033,289 E847G possibly damaging Het
Spag5 A G 11: 78,304,728 Y287C probably benign Het
Syde2 G A 3: 145,989,170 probably null Het
Synj1 C A 16: 90,948,087 V1190F possibly damaging Het
Taok1 A T 11: 77,553,704 I515N probably benign Het
Tmem259 A T 10: 79,978,595 V309E probably damaging Het
Tmem62 T A 2: 121,002,596 V494E possibly damaging Het
Trak1 A T 9: 121,443,712 E119V probably null Het
Vmn1r1 T A 1: 182,157,951 I50L probably benign Het
Xpc C T 6: 91,504,578 V254I possibly damaging Het
Zfp58 G A 13: 67,492,082 Q97* probably null Het
Zscan5b A G 7: 6,233,912 E220G possibly damaging Het
Other mutations in Nell2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Nell2 APN 15 95527285 missense possibly damaging 0.94
IGL00919:Nell2 APN 15 95383727 missense possibly damaging 0.88
IGL01124:Nell2 APN 15 95296179 missense probably damaging 1.00
IGL01356:Nell2 APN 15 95229183 missense probably damaging 0.99
IGL01865:Nell2 APN 15 95385081 missense possibly damaging 0.74
IGL02324:Nell2 APN 15 95229101 missense probably damaging 0.99
IGL02505:Nell2 APN 15 95296263 splice site probably benign
PIT4495001:Nell2 UTSW 15 95383727 missense probably benign 0.33
R0112:Nell2 UTSW 15 95431681 splice site probably benign
R0139:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0355:Nell2 UTSW 15 95432901 missense probably benign 0.13
R0481:Nell2 UTSW 15 95432682 splice site probably null
R0607:Nell2 UTSW 15 95229214 missense probably benign 0.06
R1378:Nell2 UTSW 15 95232521 missense probably damaging 1.00
R1688:Nell2 UTSW 15 95431613 missense probably damaging 0.97
R2054:Nell2 UTSW 15 95435109 missense probably benign 0.00
R2163:Nell2 UTSW 15 95429978 missense probably damaging 1.00
R2176:Nell2 UTSW 15 95435157 missense probably damaging 0.97
R3745:Nell2 UTSW 15 95432673 missense probably damaging 1.00
R5055:Nell2 UTSW 15 95473579 missense probably benign 0.00
R5184:Nell2 UTSW 15 95527809 missense possibly damaging 0.78
R5382:Nell2 UTSW 15 95229210 missense probably damaging 1.00
R6145:Nell2 UTSW 15 95473561 missense probably damaging 1.00
R6264:Nell2 UTSW 15 95346825 missense probably damaging 0.99
R6337:Nell2 UTSW 15 95385144 missense probably damaging 1.00
R6423:Nell2 UTSW 15 95527282 missense probably damaging 1.00
R6438:Nell2 UTSW 15 95232498 missense probably damaging 1.00
R6579:Nell2 UTSW 15 95385076 missense possibly damaging 0.88
R6810:Nell2 UTSW 15 95241587 missense probably damaging 1.00
R6894:Nell2 UTSW 15 95346887 missense probably damaging 1.00
R7016:Nell2 UTSW 15 95229151 missense possibly damaging 0.87
R7266:Nell2 UTSW 15 95435393 missense possibly damaging 0.50
X0038:Nell2 UTSW 15 95527812 missense probably benign
Z1088:Nell2 UTSW 15 95435097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTCGCTCTGCTGACCTAATTTG -3'
(R):5'- TGGGCACAACCTGTTCGTTGTTAC -3'

Sequencing Primer
(F):5'- ACGGCTCTTCAGAAGTGAC -3'
(R):5'- AACCTGTTCGTTGTTACTGTTG -3'
Posted On2013-06-12