Incidental Mutation 'R0535:Lnpep'
ID49444
Institutional Source Beutler Lab
Gene Symbol Lnpep
Ensembl Gene ENSMUSG00000023845
Gene Nameleucyl/cystinyl aminopeptidase
Synonymsgp160, 4732490P18Rik, 2010309L07Rik, IRAP, vp165
MMRRC Submission 038727-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0535 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location17521410-17625050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17571673 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 402 (E402G)
Ref Sequence ENSEMBL: ENSMUSP00000036998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041047]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041047
AA Change: E402G

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: E402G

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Peptidase_M1 167 552 9.2e-143 PFAM
Pfam:ERAP1_C 689 1007 1e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232515
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,748,181 F118S possibly damaging Het
Aatk A G 11: 120,010,193 S1069P probably benign Het
Acmsd A T 1: 127,765,943 I305L probably benign Het
Aco2 G A 15: 81,913,217 E625K possibly damaging Het
Acox1 G A 11: 116,174,438 T561I possibly damaging Het
Acox2 T A 14: 8,256,753 T37S probably damaging Het
Apc A T 18: 34,261,072 K17M probably damaging Het
BC027072 A G 17: 71,752,439 V81A probably benign Het
Cant1 T C 11: 118,411,143 D116G probably damaging Het
Col11a1 A G 3: 114,061,535 E148G unknown Het
Cyp51 T C 5: 4,099,202 Q225R probably benign Het
E2f8 T C 7: 48,871,810 probably benign Het
Fam163b T C 2: 27,112,766 Y73C probably benign Het
Fbxw9 T C 8: 85,064,600 C271R probably damaging Het
Gbp10 T C 5: 105,221,011 N321D possibly damaging Het
Gle1 T C 2: 29,957,805 F675L probably damaging Het
Gm6327 T C 16: 12,760,377 noncoding transcript Het
Gphn T A 12: 78,492,050 F157I possibly damaging Het
Gtpbp1 A T 15: 79,707,732 T94S probably damaging Het
Hdac2 T C 10: 36,993,899 F286L probably benign Het
Ighv3-6 A T 12: 114,288,470 probably benign Het
Itga2b A G 11: 102,457,533 V791A possibly damaging Het
Itgb4 A T 11: 115,991,009 I796F possibly damaging Het
Kel T C 6: 41,690,838 K390R probably null Het
Krt42 C T 11: 100,264,586 C368Y probably damaging Het
Lancl1 A G 1: 67,009,906 probably benign Het
Lipg A G 18: 74,954,220 Y177H probably damaging Het
Ltbp2 A T 12: 84,784,858 I1727N probably damaging Het
Ltbp2 A G 12: 84,791,052 F1185L probably damaging Het
Mettl22 T C 16: 8,484,346 probably benign Het
Mug1 G A 6: 121,851,454 G275E probably benign Het
Nell2 T A 15: 95,431,607 T278S probably benign Het
Nomo1 T A 7: 46,072,517 S961T probably damaging Het
Olfr992 A G 2: 85,400,095 L146P possibly damaging Het
Phf2 A G 13: 48,813,947 Y675H unknown Het
Phldb2 A G 16: 45,757,127 V1145A probably damaging Het
Phrf1 T C 7: 141,260,065 S1058P probably benign Het
Prss3 T C 6: 41,374,969 N120S probably benign Het
Reln G T 5: 22,051,276 probably benign Het
Soga1 T C 2: 157,033,289 E847G possibly damaging Het
Spag5 A G 11: 78,304,728 Y287C probably benign Het
Syde2 G A 3: 145,989,170 probably null Het
Synj1 C A 16: 90,948,087 V1190F possibly damaging Het
Taok1 A T 11: 77,553,704 I515N probably benign Het
Tmem259 A T 10: 79,978,595 V309E probably damaging Het
Tmem62 T A 2: 121,002,596 V494E possibly damaging Het
Trak1 A T 9: 121,443,712 E119V probably null Het
Vmn1r1 T A 1: 182,157,951 I50L probably benign Het
Xpc C T 6: 91,504,578 V254I possibly damaging Het
Zfp58 G A 13: 67,492,082 Q97* probably null Het
Zscan5b A G 7: 6,233,912 E220G possibly damaging Het
Other mutations in Lnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01983:Lnpep APN 17 17531178 missense probably damaging 1.00
IGL02008:Lnpep APN 17 17570957 missense probably benign 0.40
IGL02040:Lnpep APN 17 17544905 missense probably benign 0.13
IGL02392:Lnpep APN 17 17579183 missense possibly damaging 0.48
IGL02417:Lnpep APN 17 17544903 missense possibly damaging 0.57
IGL02659:Lnpep APN 17 17570900 missense possibly damaging 0.83
IGL02697:Lnpep APN 17 17553193 missense probably benign
IGL02947:Lnpep APN 17 17570972 missense probably damaging 1.00
IGL03493:Lnpep APN 17 17579171 missense probably damaging 1.00
I0000:Lnpep UTSW 17 17578971 missense probably damaging 1.00
PIT4504001:Lnpep UTSW 17 17579027 missense probably benign 0.00
R0528:Lnpep UTSW 17 17531132 splice site probably benign
R0540:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R0586:Lnpep UTSW 17 17575396 splice site probably benign
R0607:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R1502:Lnpep UTSW 17 17571644 missense probably damaging 1.00
R1570:Lnpep UTSW 17 17579156 missense probably damaging 1.00
R1733:Lnpep UTSW 17 17553313 missense probably benign 0.00
R1826:Lnpep UTSW 17 17562836 missense probably damaging 1.00
R2015:Lnpep UTSW 17 17579063 missense probably damaging 0.99
R2029:Lnpep UTSW 17 17568399 missense probably damaging 1.00
R4593:Lnpep UTSW 17 17579027 missense probably benign 0.00
R4638:Lnpep UTSW 17 17575307 missense probably damaging 1.00
R4741:Lnpep UTSW 17 17571658 missense probably damaging 1.00
R4919:Lnpep UTSW 17 17578911 missense probably damaging 1.00
R5030:Lnpep UTSW 17 17579309 missense probably damaging 1.00
R5111:Lnpep UTSW 17 17578610 missense possibly damaging 0.93
R5203:Lnpep UTSW 17 17537063 missense probably damaging 1.00
R5320:Lnpep UTSW 17 17546465 missense possibly damaging 0.83
R5419:Lnpep UTSW 17 17566730 missense probably damaging 1.00
R5535:Lnpep UTSW 17 17538694 missense probably benign 0.02
R5680:Lnpep UTSW 17 17579182 nonsense probably null
R6134:Lnpep UTSW 17 17553192 missense probably benign
R6142:Lnpep UTSW 17 17566681 critical splice donor site probably null
R6189:Lnpep UTSW 17 17566739 missense possibly damaging 0.46
R6225:Lnpep UTSW 17 17578983 missense possibly damaging 0.66
R6350:Lnpep UTSW 17 17562809 missense probably benign 0.01
R6357:Lnpep UTSW 17 17552914 missense probably benign 0.00
R6765:Lnpep UTSW 17 17530496 missense probably damaging 1.00
R6794:Lnpep UTSW 17 17531159 missense probably damaging 1.00
R7013:Lnpep UTSW 17 17568363 missense probably benign 0.04
R7208:Lnpep UTSW 17 17552910 nonsense probably null
R7268:Lnpep UTSW 17 17538541 missense probably benign
R7564:Lnpep UTSW 17 17578592 missense probably benign 0.22
X0004:Lnpep UTSW 17 17544812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGTCCCTACGTCTAAATGCTCGG -3'
(R):5'- TGTTTGCTGGTCCTAACAGTGCTC -3'

Sequencing Primer
(F):5'- GTTCTTCAGAACCAGTGTCACG -3'
(R):5'- CCTGCCTTTACACCATGGATT -3'
Posted On2013-06-12