Incidental Mutation 'R0536:Ttc39b'
ID49453
Institutional Source Beutler Lab
Gene Symbol Ttc39b
Ensembl Gene ENSMUSG00000038172
Gene Nametetratricopeptide repeat domain 39B
Synonyms9130422G05Rik, 1810054D07Rik
MMRRC Submission 038728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0536 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location83220300-83324255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83227198 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 597 (E597G)
Ref Sequence ENSEMBL: ENSMUSP00000099887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102823]
Predicted Effect probably damaging
Transcript: ENSMUST00000102823
AA Change: E597G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099887
Gene: ENSMUSG00000038172
AA Change: E597G

DomainStartEndE-ValueType
Pfam:DUF3808 75 533 3.6e-167 PFAM
Pfam:TPR_8 329 360 4.5e-3 PFAM
Pfam:TPR_6 563 594 6.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143362
Meta Mutation Damage Score 0.6048 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,280,516 probably benign Het
Agrn A T 4: 156,179,553 D84E probably benign Het
Akap11 A G 14: 78,514,024 S308P probably damaging Het
Atp6v1c2 A T 12: 17,307,508 probably null Het
AW209491 A G 13: 14,636,973 Y137C probably damaging Het
Chst9 G A 18: 15,495,330 probably benign Het
Dok7 A G 5: 35,066,482 T122A probably damaging Het
Hoxb5 T C 11: 96,304,028 S139P possibly damaging Het
Ikzf4 T A 10: 128,641,249 E64D probably benign Het
Kif21a C A 15: 90,959,683 probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lama3 C T 18: 12,525,894 R2036C probably damaging Het
Lrba T A 3: 86,715,532 V311D probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mylk T C 16: 35,000,387 V1903A possibly damaging Het
Naa30 C T 14: 49,173,077 A154V possibly damaging Het
Olfr617 T C 7: 103,584,261 S80P probably damaging Het
Olfr705 T A 7: 106,714,321 Y120F probably damaging Het
Olfr938 G T 9: 39,078,329 Q139K probably benign Het
Pgm3 C T 9: 86,567,536 V144M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rgsl1 T A 1: 153,826,181 S211C probably damaging Het
Setx T C 2: 29,158,248 Y1954H possibly damaging Het
Sorcs3 C T 19: 48,802,698 Q1162* probably null Het
Sptbn2 T A 19: 4,726,690 D255E probably damaging Het
Vldlr G A 19: 27,239,964 A436T probably damaging Het
Wdr72 G A 9: 74,157,408 G574D probably damaging Het
Zzz3 T G 3: 152,448,828 I572S probably damaging Het
Other mutations in Ttc39b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Ttc39b APN 4 83244039 splice site probably benign
IGL02118:Ttc39b APN 4 83297949 missense probably damaging 1.00
IGL02860:Ttc39b APN 4 83263746 missense probably benign 0.14
IGL03008:Ttc39b APN 4 83247695 missense probably benign 0.00
IGL03136:Ttc39b APN 4 83237280 missense probably damaging 0.97
IGL03310:Ttc39b APN 4 83247659 missense probably benign 0.00
IGL03409:Ttc39b APN 4 83260956 missense probably damaging 1.00
R0654:Ttc39b UTSW 4 83241701 missense probably benign 0.03
R1690:Ttc39b UTSW 4 83227177 missense probably damaging 1.00
R1758:Ttc39b UTSW 4 83237349 missense probably damaging 1.00
R1933:Ttc39b UTSW 4 83232720 missense possibly damaging 0.87
R2221:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R2223:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R4182:Ttc39b UTSW 4 83237301 missense probably damaging 1.00
R4746:Ttc39b UTSW 4 83244103 missense probably benign 0.01
R4984:Ttc39b UTSW 4 83242209 missense probably benign 0.05
R5328:Ttc39b UTSW 4 83261941 missense probably damaging 1.00
R5360:Ttc39b UTSW 4 83261847 missense probably damaging 1.00
R5429:Ttc39b UTSW 4 83243953 missense possibly damaging 0.50
R5646:Ttc39b UTSW 4 83244070 missense probably damaging 1.00
R6353:Ttc39b UTSW 4 83230493 missense probably benign 0.07
R6681:Ttc39b UTSW 4 83240048 intron probably benign
R6873:Ttc39b UTSW 4 83246276 missense probably damaging 1.00
R7274:Ttc39b UTSW 4 83261851 missense possibly damaging 0.95
R7414:Ttc39b UTSW 4 83242222 missense probably damaging 0.99
R7536:Ttc39b UTSW 4 83239978 nonsense probably null
X0064:Ttc39b UTSW 4 83260939 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTGAGATACAAGTCCCTTCTGCC -3'
(R):5'- AGAAAGACGCTGCTCTTTACTCTGC -3'

Sequencing Primer
(F):5'- AACTAGGCTTTATTGTACCTGCCAG -3'
(R):5'- TCTTTACTCTGCTCCAGTAGAAC -3'
Posted On2013-06-12