Incidental Mutation 'R0536:Olfr938'
ID 49460
Institutional Source Beutler Lab
Gene Symbol Olfr938
Ensembl Gene ENSMUSG00000048501
Gene Name olfactory receptor 938
Synonyms GA_x6K02T2PVTD-32774646-32773699, MOR171-25
MMRRC Submission 038728-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R0536 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 39077698-39078887 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 39078329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 139 (Q139K)
Ref Sequence ENSEMBL: ENSMUSP00000055053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056499]
AlphaFold Q9EQ93
Predicted Effect probably benign
Transcript: ENSMUST00000056499
AA Change: Q139K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000055053
Gene: ENSMUSG00000048501
AA Change: Q139K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8e-49 PFAM
Pfam:7tm_1 41 290 5.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175411
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215888
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,280,516 probably benign Het
Agrn A T 4: 156,179,553 D84E probably benign Het
Akap11 A G 14: 78,514,024 S308P probably damaging Het
Atp6v1c2 A T 12: 17,307,508 probably null Het
AW209491 A G 13: 14,636,973 Y137C probably damaging Het
Chst9 G A 18: 15,495,330 probably benign Het
Dok7 A G 5: 35,066,482 T122A probably damaging Het
Hoxb5 T C 11: 96,304,028 S139P possibly damaging Het
Ikzf4 T A 10: 128,641,249 E64D probably benign Het
Kif21a C A 15: 90,959,683 probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lama3 C T 18: 12,525,894 R2036C probably damaging Het
Lrba T A 3: 86,715,532 V311D probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mylk T C 16: 35,000,387 V1903A possibly damaging Het
Naa30 C T 14: 49,173,077 A154V possibly damaging Het
Olfr617 T C 7: 103,584,261 S80P probably damaging Het
Olfr705 T A 7: 106,714,321 Y120F probably damaging Het
Pgm3 C T 9: 86,567,536 V144M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rgsl1 T A 1: 153,826,181 S211C probably damaging Het
Setx T C 2: 29,158,248 Y1954H possibly damaging Het
Sorcs3 C T 19: 48,802,698 Q1162* probably null Het
Sptbn2 T A 19: 4,726,690 D255E probably damaging Het
Ttc39b T C 4: 83,227,198 E597G probably damaging Het
Vldlr G A 19: 27,239,964 A436T probably damaging Het
Wdr72 G A 9: 74,157,408 G574D probably damaging Het
Zzz3 T G 3: 152,448,828 I572S probably damaging Het
Other mutations in Olfr938
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr938 APN 9 39078451 missense probably damaging 0.96
IGL01298:Olfr938 APN 9 39078724 missense possibly damaging 0.63
IGL02930:Olfr938 APN 9 39078012 missense probably damaging 1.00
IGL03346:Olfr938 APN 9 39077962 missense probably damaging 0.99
IGL03346:Olfr938 APN 9 39077961 missense probably benign 0.35
IGL03399:Olfr938 APN 9 39078237 nonsense probably null
R1170:Olfr938 UTSW 9 39078229 missense possibly damaging 0.50
R1951:Olfr938 UTSW 9 39078284 missense probably benign 0.07
R1952:Olfr938 UTSW 9 39078284 missense probably benign 0.07
R2066:Olfr938 UTSW 9 39078214 missense probably damaging 1.00
R2906:Olfr938 UTSW 9 39078373 missense probably benign 0.39
R4707:Olfr938 UTSW 9 39078262 missense probably benign 0.00
R4767:Olfr938 UTSW 9 39078692 missense possibly damaging 0.71
R4951:Olfr938 UTSW 9 39078259 missense probably benign 0.10
R5888:Olfr938 UTSW 9 39077967 nonsense probably null
R5905:Olfr938 UTSW 9 39078083 missense probably damaging 1.00
R6028:Olfr938 UTSW 9 39078083 missense probably damaging 1.00
R6329:Olfr938 UTSW 9 39077903 missense probably benign 0.02
R7240:Olfr938 UTSW 9 39078610 missense probably damaging 0.99
R7345:Olfr938 UTSW 9 39078334 missense probably damaging 1.00
R8058:Olfr938 UTSW 9 39078566 missense probably damaging 1.00
R9023:Olfr938 UTSW 9 39078011 missense probably benign 0.09
R9547:Olfr938 UTSW 9 39078631 missense probably damaging 0.99
X0062:Olfr938 UTSW 9 39078466 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTCTGCCTCCAGTGGATTGAATGTG -3'
(R):5'- TCCCAAAATGCTGTTGAACTTTGTGAC -3'

Sequencing Primer
(F):5'- TCCAGTGGATTGAATGTGGAGAAC -3'
(R):5'- CTGTTGAACTTTGTGACAGAGATG -3'
Posted On 2013-06-12