Incidental Mutation 'R0536:Atp6v1c2'
ID49466
Institutional Source Beutler Lab
Gene Symbol Atp6v1c2
Ensembl Gene ENSMUSG00000020566
Gene NameATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms
MMRRC Submission 038728-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R0536 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location17284721-17329359 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 17307508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020884] [ENSMUST00000095820] [ENSMUST00000127185] [ENSMUST00000140751] [ENSMUST00000143131] [ENSMUST00000153090] [ENSMUST00000156727] [ENSMUST00000221129] [ENSMUST00000222103]
Predicted Effect probably null
Transcript: ENSMUST00000020884
SMART Domains Protein: ENSMUSP00000020884
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 427 3.9e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095820
SMART Domains Protein: ENSMUSP00000093500
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 417 3.4e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127185
SMART Domains Protein: ENSMUSP00000118635
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 1 63 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140751
SMART Domains Protein: ENSMUSP00000123415
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 133 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143131
SMART Domains Protein: ENSMUSP00000117993
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 70 5.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153090
SMART Domains Protein: ENSMUSP00000119686
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 134 3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156727
SMART Domains Protein: ENSMUSP00000117139
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 1 347 2.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221129
Predicted Effect probably benign
Transcript: ENSMUST00000222103
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (29/29)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A,three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain C subunit isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,280,516 probably benign Het
Agrn A T 4: 156,179,553 D84E probably benign Het
Akap11 A G 14: 78,514,024 S308P probably damaging Het
AW209491 A G 13: 14,636,973 Y137C probably damaging Het
Chst9 G A 18: 15,495,330 probably benign Het
Dok7 A G 5: 35,066,482 T122A probably damaging Het
Hoxb5 T C 11: 96,304,028 S139P possibly damaging Het
Ikzf4 T A 10: 128,641,249 E64D probably benign Het
Kif21a C A 15: 90,959,683 probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lama3 C T 18: 12,525,894 R2036C probably damaging Het
Lrba T A 3: 86,715,532 V311D probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mylk T C 16: 35,000,387 V1903A possibly damaging Het
Naa30 C T 14: 49,173,077 A154V possibly damaging Het
Olfr617 T C 7: 103,584,261 S80P probably damaging Het
Olfr705 T A 7: 106,714,321 Y120F probably damaging Het
Olfr938 G T 9: 39,078,329 Q139K probably benign Het
Pgm3 C T 9: 86,567,536 V144M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rgsl1 T A 1: 153,826,181 S211C probably damaging Het
Setx T C 2: 29,158,248 Y1954H possibly damaging Het
Sorcs3 C T 19: 48,802,698 Q1162* probably null Het
Sptbn2 T A 19: 4,726,690 D255E probably damaging Het
Ttc39b T C 4: 83,227,198 E597G probably damaging Het
Vldlr G A 19: 27,239,964 A436T probably damaging Het
Wdr72 G A 9: 74,157,408 G574D probably damaging Het
Zzz3 T G 3: 152,448,828 I572S probably damaging Het
Other mutations in Atp6v1c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Atp6v1c2 APN 12 17308293 missense probably damaging 1.00
IGL01520:Atp6v1c2 APN 12 17297753 missense probably damaging 1.00
IGL02121:Atp6v1c2 APN 12 17291440 missense possibly damaging 0.65
IGL02990:Atp6v1c2 APN 12 17294740 missense probably damaging 1.00
IGL03243:Atp6v1c2 APN 12 17289121 missense probably benign 0.07
R0077:Atp6v1c2 UTSW 12 17321612 missense probably damaging 1.00
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0358:Atp6v1c2 UTSW 12 17284960 splice site probably benign
R0373:Atp6v1c2 UTSW 12 17288168 missense probably damaging 1.00
R1164:Atp6v1c2 UTSW 12 17308316 missense probably damaging 1.00
R1400:Atp6v1c2 UTSW 12 17289130 missense probably benign 0.13
R2133:Atp6v1c2 UTSW 12 17321611 missense probably benign 0.03
R4695:Atp6v1c2 UTSW 12 17301207 missense probably benign 0.02
R4825:Atp6v1c2 UTSW 12 17289060 missense probably benign 0.02
R5215:Atp6v1c2 UTSW 12 17291658 missense probably benign 0.08
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6196:Atp6v1c2 UTSW 12 17301186 nonsense probably null
R7059:Atp6v1c2 UTSW 12 17289004 nonsense probably null
R7505:Atp6v1c2 UTSW 12 17297723 splice site probably null
R7559:Atp6v1c2 UTSW 12 17301214 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GAGAAACTGCTGAGCCCTGATCAC -3'
(R):5'- GCTGATAGACACAGAATCCGATGCC -3'

Sequencing Primer
(F):5'- GAGCCCTGATCACTGTACC -3'
(R):5'- GGCAGAAAATGGGAACACTC -3'
Posted On2013-06-12