Mutagenetix > Incidental Mutation

Incidental Mutation 'R0536:Mylk'

49471

Institutional Source

Beutler Lab

Gene Symbol

Mylk

Ensembl Gene

ENSMUSG00000022836

Gene Name

myosin, light polypeptide kinase

Synonyms

Mlck, telokin, nmMlck, 9530072E15Rik, A930019C19Rik, MLCK108, MLCK210

MMRRC Submission

038728-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0536 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34565580-34822790 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34820757 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1903 (V1903A)

Ref Sequence

ENSEMBL: ENSMUSP00000023538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023538] [ENSMUST00000231589]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023538
AA Change: V1903A

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: V1903A

Domain	Start	End	E-Value	Type
IGc2	54	122	9.05e-11	SMART
IGc2	177	244	3.94e-11	SMART
Pfam:23ISL	255	409	3.6e-60	PFAM
IGc2	423	491	1.55e-9	SMART
IGc2	523	587	3.32e-18	SMART
IGc2	632	699	6.02e-7	SMART
IGc2	730	798	1.36e-5	SMART
low complexity region	827	844	N/A	INTRINSIC
IGc2	1141	1208	2.42e-11	SMART
low complexity region	1251	1269	N/A	INTRINSIC
IG	1275	1359	4.56e-7	SMART
FN3	1362	1444	2.33e-11	SMART
low complexity region	1457	1479	N/A	INTRINSIC
S_TKc	1495	1750	4.23e-95	SMART
IGc2	1852	1920	5.92e-15	SMART
low complexity region	1934	1950	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000231589
AA Change: V112A

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232358

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232477

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232548

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232649

Meta Mutation Damage Score

0.3841

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.1%

Validation Efficiency

100% (29/29)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,171,342 (GRCm39)		probably benign	Het
Agrn	A	T	4: 156,264,010 (GRCm39)	D84E	probably benign	Het
Akap11	A	G	14: 78,751,464 (GRCm39)	S308P	probably damaging	Het
Atp6v1c2	A	T	12: 17,357,509 (GRCm39)		probably null	Het
AW209491	A	G	13: 14,811,558 (GRCm39)	Y137C	probably damaging	Het
Chst9	G	A	18: 15,628,387 (GRCm39)		probably benign	Het
Dok7	A	G	5: 35,223,826 (GRCm39)	T122A	probably damaging	Het
Hoxb5	T	C	11: 96,194,854 (GRCm39)	S139P	possibly damaging	Het
Ikzf4	T	A	10: 128,477,118 (GRCm39)	E64D	probably benign	Het
Kif21a	C	A	15: 90,843,886 (GRCm39)		probably benign	Het
Klhl41	G	A	2: 69,500,554 (GRCm39)	R5Q	probably benign	Het
Lama3	C	T	18: 12,658,951 (GRCm39)	R2036C	probably damaging	Het
Lrba	T	A	3: 86,622,839 (GRCm39)	V311D	probably damaging	Het
Mroh2a	A	G	1: 88,186,386 (GRCm39)	S64G	probably benign	Het
Naa30	C	T	14: 49,410,534 (GRCm39)	A154V	possibly damaging	Het
Or2ag1	T	A	7: 106,313,528 (GRCm39)	Y120F	probably damaging	Het
Or52z12	T	C	7: 103,233,468 (GRCm39)	S80P	probably damaging	Het
Or8g24	G	T	9: 38,989,625 (GRCm39)	Q139K	probably benign	Het
Pgm3	C	T	9: 86,449,589 (GRCm39)	V144M	possibly damaging	Het
Ptpro	T	A	6: 137,420,592 (GRCm39)	V1007D	probably damaging	Het
Rgsl1	T	A	1: 153,701,927 (GRCm39)	S211C	probably damaging	Het
Setx	T	C	2: 29,048,260 (GRCm39)	Y1954H	possibly damaging	Het
Sorcs3	C	T	19: 48,791,137 (GRCm39)	Q1162*	probably null	Het
Sptbn2	T	A	19: 4,776,718 (GRCm39)	D255E	probably damaging	Het
Ttc39b	T	C	4: 83,145,435 (GRCm39)	E597G	probably damaging	Het
Vldlr	G	A	19: 27,217,364 (GRCm39)	A436T	probably damaging	Het
Wdr72	G	A	9: 74,064,690 (GRCm39)	G574D	probably damaging	Het
Zzz3	T	G	3: 152,154,465 (GRCm39)	I572S	probably damaging	Het

Other mutations in Mylk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01384:Mylk	APN	16	34,759,322 (GRCm39)	missense	probably benign	0.36
IGL01386:Mylk	APN	16	34,791,610 (GRCm39)	critical splice acceptor site	probably null
IGL01684:Mylk	APN	16	34,792,310 (GRCm39)	missense	possibly damaging	0.55
IGL01884:Mylk	APN	16	34,809,247 (GRCm39)	splice site	probably benign
IGL02079:Mylk	APN	16	34,681,001 (GRCm39)	missense	possibly damaging	0.87
IGL02104:Mylk	APN	16	34,635,805 (GRCm39)	missense	probably benign	0.06
IGL02624:Mylk	APN	16	34,750,266 (GRCm39)	missense	probably benign	0.29
IGL02756:Mylk	APN	16	34,784,016 (GRCm39)	missense	probably benign	0.42
IGL02794:Mylk	APN	16	34,806,911 (GRCm39)	missense	probably benign	0.21
IGL02833:Mylk	APN	16	34,735,270 (GRCm39)	missense	probably benign	0.01
IGL02946:Mylk	APN	16	34,742,158 (GRCm39)	missense	probably benign	0.10
IGL03012:Mylk	APN	16	34,773,151 (GRCm39)	missense	probably benign	0.03
IGL03093:Mylk	APN	16	34,732,562 (GRCm39)	missense	possibly damaging	0.62
IGL03272:Mylk	APN	16	34,799,559 (GRCm39)	missense	probably benign	0.09
billy	UTSW	16	34,695,990 (GRCm39)	missense	probably damaging	0.97
brutus	UTSW	16	34,774,065 (GRCm39)	missense	probably benign	0.12
Club	UTSW	16	34,732,645 (GRCm39)	nonsense	probably null
popeye	UTSW	16	34,783,947 (GRCm39)	missense	probably benign	0.29
F5770:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
P4717OSA:Mylk	UTSW	16	34,797,483 (GRCm39)	splice site	probably benign
PIT4382001:Mylk	UTSW	16	34,696,012 (GRCm39)	missense	probably damaging	0.99
R0131:Mylk	UTSW	16	34,695,874 (GRCm39)	missense	probably benign	0.03
R0309:Mylk	UTSW	16	34,732,667 (GRCm39)	splice site	probably benign
R0358:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0381:Mylk	UTSW	16	34,605,344 (GRCm39)	splice site	probably null
R0390:Mylk	UTSW	16	34,695,990 (GRCm39)	missense	probably damaging	0.97
R0413:Mylk	UTSW	16	34,742,314 (GRCm39)	missense	probably benign	0.01
R0544:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0545:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0546:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0547:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0548:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0627:Mylk	UTSW	16	34,820,799 (GRCm39)	missense	probably damaging	1.00
R0726:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0755:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0782:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0783:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R0784:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R1136:Mylk	UTSW	16	34,820,688 (GRCm39)	missense	probably damaging	1.00
R1170:Mylk	UTSW	16	34,694,409 (GRCm39)	missense	probably benign	0.20
R1222:Mylk	UTSW	16	34,681,022 (GRCm39)	missense	probably benign	0.12
R1445:Mylk	UTSW	16	34,635,835 (GRCm39)	missense	possibly damaging	0.57
R1583:Mylk	UTSW	16	34,695,956 (GRCm39)	missense	probably benign	0.29
R1618:Mylk	UTSW	16	34,699,845 (GRCm39)	missense	possibly damaging	0.74
R1643:Mylk	UTSW	16	34,696,005 (GRCm39)	missense	probably benign	0.03
R1702:Mylk	UTSW	16	34,742,314 (GRCm39)	missense	probably benign	0.00
R1776:Mylk	UTSW	16	34,773,152 (GRCm39)	missense	probably benign	0.16
R1865:Mylk	UTSW	16	34,732,600 (GRCm39)	missense	probably benign	0.03
R1975:Mylk	UTSW	16	34,700,673 (GRCm39)	splice site	probably null
R2016:Mylk	UTSW	16	34,817,187 (GRCm39)	missense	probably damaging	1.00
R2045:Mylk	UTSW	16	34,774,023 (GRCm39)	missense	probably benign	0.29
R2134:Mylk	UTSW	16	34,806,846 (GRCm39)	missense	probably benign	0.13
R3547:Mylk	UTSW	16	34,700,538 (GRCm39)	missense	possibly damaging	0.61
R3844:Mylk	UTSW	16	34,742,247 (GRCm39)	missense	probably benign	0.01
R4003:Mylk	UTSW	16	34,783,947 (GRCm39)	missense	probably benign	0.29
R4396:Mylk	UTSW	16	34,732,645 (GRCm39)	nonsense	probably null
R4470:Mylk	UTSW	16	34,732,522 (GRCm39)	missense	probably benign	0.09
R4507:Mylk	UTSW	16	34,774,065 (GRCm39)	missense	probably benign	0.12
R4700:Mylk	UTSW	16	34,742,805 (GRCm39)	missense	probably benign	0.16
R4751:Mylk	UTSW	16	34,699,539 (GRCm39)	missense	probably benign	0.29
R4815:Mylk	UTSW	16	34,715,295 (GRCm39)	missense	probably damaging	0.97
R4832:Mylk	UTSW	16	34,742,737 (GRCm39)	missense	probably benign	0.36
R4872:Mylk	UTSW	16	34,735,360 (GRCm39)	missense	possibly damaging	0.89
R4953:Mylk	UTSW	16	34,809,331 (GRCm39)	missense	probably damaging	1.00
R4969:Mylk	UTSW	16	34,791,810 (GRCm39)	missense	probably damaging	0.96
R5009:Mylk	UTSW	16	34,719,877 (GRCm39)	missense	probably benign	0.39
R5130:Mylk	UTSW	16	34,809,367 (GRCm39)	missense	probably damaging	1.00
R5173:Mylk	UTSW	16	34,797,383 (GRCm39)	missense	probably benign	0.40
R5195:Mylk	UTSW	16	34,799,585 (GRCm39)	missense	probably damaging	1.00
R5209:Mylk	UTSW	16	34,742,995 (GRCm39)	missense	possibly damaging	0.55
R5311:Mylk	UTSW	16	34,742,127 (GRCm39)	missense	probably benign	0.01
R5418:Mylk	UTSW	16	34,732,600 (GRCm39)	missense	probably benign	0.02
R5481:Mylk	UTSW	16	34,741,974 (GRCm39)	missense	probably benign	0.09
R5590:Mylk	UTSW	16	34,699,722 (GRCm39)	missense	probably benign	0.29
R5603:Mylk	UTSW	16	34,776,862 (GRCm39)	missense	probably benign	0.06
R5823:Mylk	UTSW	16	34,715,317 (GRCm39)	critical splice donor site	probably null
R6290:Mylk	UTSW	16	34,715,213 (GRCm39)	missense	probably benign	0.39
R6351:Mylk	UTSW	16	34,742,341 (GRCm39)	missense	probably benign	0.01
R6365:Mylk	UTSW	16	34,680,961 (GRCm39)	missense	probably benign	0.12
R6490:Mylk	UTSW	16	34,750,237 (GRCm39)	missense	possibly damaging	0.74
R6723:Mylk	UTSW	16	34,750,258 (GRCm39)	missense	possibly damaging	0.74
R6864:Mylk	UTSW	16	34,694,520 (GRCm39)	missense	probably benign	0.03
R6908:Mylk	UTSW	16	34,700,643 (GRCm39)	missense	probably benign	0.18
R6949:Mylk	UTSW	16	34,820,688 (GRCm39)	missense	probably damaging	1.00
R7018:Mylk	UTSW	16	34,820,796 (GRCm39)	missense	possibly damaging	0.88
R7035:Mylk	UTSW	16	34,797,352 (GRCm39)	missense	possibly damaging	0.89
R7162:Mylk	UTSW	16	34,742,899 (GRCm39)	missense	probably damaging	1.00
R7236:Mylk	UTSW	16	34,742,899 (GRCm39)	missense	probably damaging	1.00
R7269:Mylk	UTSW	16	34,605,381 (GRCm39)	missense	probably damaging	0.96
R7475:Mylk	UTSW	16	34,734,446 (GRCm39)	splice site	probably null
R7525:Mylk	UTSW	16	34,809,357 (GRCm39)	missense	probably benign	0.06
R7587:Mylk	UTSW	16	34,742,887 (GRCm39)	missense	probably benign	0.29
R7607:Mylk	UTSW	16	34,715,184 (GRCm39)	missense	probably benign	0.09
R7616:Mylk	UTSW	16	34,699,927 (GRCm39)	missense	probably damaging	0.97
R7647:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7648:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7764:Mylk	UTSW	16	34,742,553 (GRCm39)	missense	probably benign	0.16
R7890:Mylk	UTSW	16	34,784,018 (GRCm39)	nonsense	probably null
R7892:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R7893:Mylk	UTSW	16	34,699,894 (GRCm39)	missense	probably benign	0.29
R8065:Mylk	UTSW	16	34,792,389 (GRCm39)	missense	probably benign	0.08
R8067:Mylk	UTSW	16	34,792,389 (GRCm39)	missense	probably benign	0.08
R8143:Mylk	UTSW	16	34,734,525 (GRCm39)	missense	possibly damaging	0.87
R8210:Mylk	UTSW	16	34,820,721 (GRCm39)	missense	probably damaging	1.00
R8271:Mylk	UTSW	16	34,742,949 (GRCm39)	missense	probably damaging	0.97
R8540:Mylk	UTSW	16	34,750,257 (GRCm39)	missense	possibly damaging	0.87
R8721:Mylk	UTSW	16	34,817,176 (GRCm39)	missense	probably damaging	1.00
R8743:Mylk	UTSW	16	34,741,427 (GRCm39)	missense	probably benign	0.03
R8798:Mylk	UTSW	16	34,719,772 (GRCm39)	missense	possibly damaging	0.89
R8956:Mylk	UTSW	16	34,791,779 (GRCm39)	missense	probably benign	0.01
R9131:Mylk	UTSW	16	34,776,835 (GRCm39)	missense	probably benign	0.29
R9403:Mylk	UTSW	16	34,696,012 (GRCm39)	nonsense	probably null
R9624:Mylk	UTSW	16	34,699,677 (GRCm39)	missense	probably benign	0.29
R9735:Mylk	UTSW	16	34,735,179 (GRCm39)	missense	probably benign	0.09
R9756:Mylk	UTSW	16	34,734,387 (GRCm39)	missense	probably damaging	0.96
R9763:Mylk	UTSW	16	34,699,482 (GRCm39)	nonsense	probably null
RF001:Mylk	UTSW	16	34,699,741 (GRCm39)	missense	probably benign	0.03
V7580:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
V7583:Mylk	UTSW	16	34,815,574 (GRCm39)	critical splice donor site	probably null
X0065:Mylk	UTSW	16	34,820,811 (GRCm39)	missense	probably damaging	1.00
Z1177:Mylk	UTSW	16	34,743,021 (GRCm39)	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- GCCAACCTCGTGCTTTAATCAACAG -3'
(R):5'- AGTATATCTCCCAGGCATCAGCCG -3'

Sequencing Primer
(F):5'- GTACCCTGAGAGCCTCTTGATTG -3'
(R):5'- GCCTTTTCTAGCTTTGGtttttttg -3'

Posted On

2013-06-12