Mutagenetix > Incidental Mutations

Incidental Mutation 'R0537:Rasal2'

49478

Institutional Source

Beutler Lab

Gene Symbol

Rasal2

Ensembl Gene

ENSMUSG00000070565

Gene Name

RAS protein activator like 2

Synonyms

A330066M24Rik

MMRRC Submission

038729-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0537 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

157135182-157412595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 157147792 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1149 (V1149E)

Ref Sequence

ENSEMBL: ENSMUSP00000077423 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000132699]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078308
AA Change: V1149E

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: V1149E

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
PH	58	307	3.97e-8	SMART
C2	317	413	6.01e-10	SMART
RasGAP	423	767	4.56e-157	SMART
low complexity region	780	791	N/A	INTRINSIC
low complexity region	1063	1075	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
coiled coil region	1117	1236	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132699
AA Change: V1124E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: V1124E

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
PH	40	289	1.7e-10	SMART
C2	299	395	4e-12	SMART
RasGAP	405	742	4.2e-153	SMART
low complexity region	755	766	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1059	1067	N/A	INTRINSIC
coiled coil region	1092	1211	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	A	T	14: 36,096,700	K218N	probably benign	Het
Acot11	T	C	4: 106,762,455	E156G	probably benign	Het
Arhgef28	A	T	13: 97,957,716	N973K	probably damaging	Het
B4galt3	T	C	1: 171,274,251		probably benign	Het
Bmpr1a	T	C	14: 34,443,812		probably benign	Het
Camkmt	A	T	17: 85,394,659	I184F	probably benign	Het
Ccdc33	T	C	9: 58,117,454	Y163C	probably damaging	Het
Ccdc9	A	G	7: 16,280,776		probably benign	Het
Dars2	A	T	1: 161,060,748	C201S	possibly damaging	Het
Dnajc1	A	T	2: 18,307,956	S194R	possibly damaging	Het
Dock8	A	G	19: 25,171,577	D1473G	probably benign	Het
Dpm2	T	A	2: 32,572,949		probably null	Het
Dsg4	T	C	18: 20,458,571	S456P	probably damaging	Het
Gm10260	A	T	13: 97,760,563	F9Y	probably benign	Het
Gys1	T	C	7: 45,440,001	S195P	probably damaging	Het
Heatr6	G	T	11: 83,779,464	E948*	probably null	Het
Itgal	G	A	7: 127,311,273	R518Q	possibly damaging	Het
Klhdc8b	G	C	9: 108,449,223	R158G	possibly damaging	Het
Klhl41	G	A	2: 69,670,210	R5Q	probably benign	Het
Lrrtm4	A	T	6: 80,022,120	T172S	probably benign	Het
Lypd1	A	G	1: 125,912,867		probably benign	Het
Mei1	T	C	15: 82,091,361	F121S	possibly damaging	Het
Mtor	C	T	4: 148,538,360	R1966W	probably damaging	Het
Myh7	A	G	14: 54,990,799	F247L	possibly damaging	Het
Nebl	G	T	2: 17,404,215	D392E	possibly damaging	Het
Notch2	C	A	3: 98,116,741	N840K	possibly damaging	Het
Nubp1	T	C	16: 10,422,814		probably benign	Het
Olfr1140	A	T	2: 87,746,673	Q159L	probably benign	Het
Olfr832	T	C	9: 18,945,148	S167P	probably damaging	Het
Pcdh17	T	A	14: 84,447,457	S455T	probably damaging	Het
Picalm	C	A	7: 90,130,668	H32Q	probably benign	Het
Pold1	T	C	7: 44,535,092	E828G	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rala	A	T	13: 17,888,648	N119K	probably benign	Het
Rd3	A	G	1: 191,983,540	Y92C	probably damaging	Het
Sart1	A	T	19: 5,381,724	D635E	probably damaging	Het
Sec16b	A	G	1: 157,537,546	T335A	possibly damaging	Het
Slc11a2	C	T	15: 100,405,798	G185R	probably damaging	Het
Slc2a12	G	A	10: 22,665,068	R274H	probably damaging	Het
Spag17	T	C	3: 100,125,302	V2276A	probably damaging	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tenm2	T	C	11: 36,163,730	D601G	probably damaging	Het
Tmem168	C	A	6: 13,603,361	C2F	probably damaging	Het
Tmem80	A	G	7: 141,333,696	Y13C	probably damaging	Het
Try4	T	A	6: 41,304,362	N79K	probably benign	Het
Vldlr	C	A	19: 27,247,918	N798K	probably damaging	Het
Wdr41	A	G	13: 94,995,305		probably benign	Het
Zfp30	A	T	7: 29,792,735	E138V	probably damaging	Het
Zfp366	A	C	13: 99,229,278	T316P	probably damaging	Het
Zfp563	A	T	17: 33,104,685	S85C	possibly damaging	Het
Znfx1	T	C	2: 167,041,701	H162R	probably damaging	Het

Other mutations in Rasal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Rasal2	APN	1	157147817	missense	probably benign
IGL00484:Rasal2	APN	1	157174175	splice site	probably null
IGL00731:Rasal2	APN	1	157157764	missense	probably benign	0.01
IGL00900:Rasal2	APN	1	157411929	missense	possibly damaging	0.73
IGL01346:Rasal2	APN	1	157161216	missense	probably benign	0.19
IGL01635:Rasal2	APN	1	157163824	missense	probably damaging	1.00
IGL01759:Rasal2	APN	1	157175932	missense	probably benign	0.42
IGL01939:Rasal2	APN	1	157175910	missense	probably damaging	1.00
IGL01954:Rasal2	APN	1	157177699	missense	possibly damaging	0.83
IGL01954:Rasal2	APN	1	157176116	missense	probably damaging	0.99
IGL02005:Rasal2	APN	1	157156998	nonsense	probably null
IGL02056:Rasal2	APN	1	157299261	missense	probably damaging	0.99
IGL02444:Rasal2	APN	1	157299195	missense	probably benign	0.20
IGL02496:Rasal2	APN	1	157149879	missense	possibly damaging	0.69
IGL02832:Rasal2	APN	1	157157207	missense	probably damaging	1.00
IGL03351:Rasal2	APN	1	157192741	splice site	probably benign
R0456:Rasal2	UTSW	1	157149843	missense	probably damaging	1.00
R0681:Rasal2	UTSW	1	157157180	missense	possibly damaging	0.70
R0682:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0683:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0787:Rasal2	UTSW	1	157158696	missense	probably damaging	1.00
R0789:Rasal2	UTSW	1	157157321	missense	probably damaging	1.00
R1109:Rasal2	UTSW	1	157177638	unclassified	probably benign
R1175:Rasal2	UTSW	1	157147648	missense	probably damaging	1.00
R1332:Rasal2	UTSW	1	157175821	missense	probably benign	0.00
R1396:Rasal2	UTSW	1	157164666	missense	probably damaging	1.00
R1535:Rasal2	UTSW	1	157230059	missense	probably benign	0.28
R1542:Rasal2	UTSW	1	157175851	missense	possibly damaging	0.84
R1703:Rasal2	UTSW	1	157157600	missense	probably damaging	1.00
R1735:Rasal2	UTSW	1	157174160	missense	probably damaging	1.00
R1762:Rasal2	UTSW	1	157299144	missense	possibly damaging	0.52
R2570:Rasal2	UTSW	1	157161300	missense	possibly damaging	0.85
R3148:Rasal2	UTSW	1	157243764	intron	probably benign
R3157:Rasal2	UTSW	1	157158655	splice site	probably benign
R4277:Rasal2	UTSW	1	157157126	missense	possibly damaging	0.46
R4459:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4460:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4563:Rasal2	UTSW	1	157175991	missense	probably damaging	1.00
R4672:Rasal2	UTSW	1	157243661	missense	probably benign	0.10
R4894:Rasal2	UTSW	1	157192804	missense	probably damaging	0.97
R5147:Rasal2	UTSW	1	157175694	missense	probably damaging	1.00
R5387:Rasal2	UTSW	1	157157765	missense	possibly damaging	0.81
R5421:Rasal2	UTSW	1	157299141	missense	probably benign	0.37
R5459:Rasal2	UTSW	1	157157661	missense	probably damaging	0.99
R5651:Rasal2	UTSW	1	157157381	missense	probably damaging	1.00
R5767:Rasal2	UTSW	1	157176162	missense	probably damaging	1.00
R5778:Rasal2	UTSW	1	157161290	missense	probably damaging	1.00
R6298:Rasal2	UTSW	1	157411862	missense	possibly damaging	0.85
R6332:Rasal2	UTSW	1	157299187	missense	probably damaging	1.00
R6571:Rasal2	UTSW	1	157161179	missense	possibly damaging	0.72
R7258:Rasal2	UTSW	1	157157700	missense	probably damaging	0.96
R7545:Rasal2	UTSW	1	157192769	missense	possibly damaging	0.93
R7558:Rasal2	UTSW	1	157175836	missense	probably damaging	0.99
R7894:Rasal2	UTSW	1	157243648	missense	probably benign	0.01
R8140:Rasal2	UTSW	1	157299235	missense	probably damaging	0.97
R8141:Rasal2	UTSW	1	157164670	missense	possibly damaging	0.89
R8151:Rasal2	UTSW	1	157243584	missense	probably damaging	0.96
R8218:Rasal2	UTSW	1	157157381	missense	probably damaging	0.99
RF024:Rasal2	UTSW	1	157147790	missense	probably damaging	0.97
Z1177:Rasal2	UTSW	1	157175673	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGTGGTCTTCTAACCTGCTGATG -3'
(R):5'- TGCCCTCAGTTGTCTGAAGGGTAAG -3'

Sequencing Primer
(F):5'- AACCTGCTGATGATGCTTTTC -3'
(R):5'- GACTTTAGACATGACAGTGCTTCC -3'

Posted On

2013-06-12