Incidental Mutation 'R0537:Dars2'
ID49480
Institutional Source Beutler Lab
Gene Symbol Dars2
Ensembl Gene ENSMUSG00000026709
Gene Nameaspartyl-tRNA synthetase 2 (mitochondrial)
Synonyms5830468K18Rik
MMRRC Submission 038729-MU
Accession Numbers

Ncbi RefSeq: NM_172644.3; MGI: 2442510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0537 (G1)
Quality Score192
Status Validated
Chromosome1
Chromosomal Location161040601-161070658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 161060748 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 201 (C201S)
Ref Sequence ENSEMBL: ENSMUSP00000041851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035430]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035430
AA Change: C201S

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041851
Gene: ENSMUSG00000026709
AA Change: C201S

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 65 148 7e-10 PFAM
Pfam:tRNA-synt_2 165 607 1.2e-90 PFAM
Pfam:GAD 355 451 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162398
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162654
Meta Mutation Damage Score 0.1598 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. It is a mitochondrial enzyme that specifically aminoacylates aspartyl-tRNA. Mutations in this gene are associated with leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). [provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Dars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Dars2 UTSW 1 161053939 critical splice donor site probably null
R0230:Dars2 UTSW 1 161062787 missense probably benign 0.02
R0709:Dars2 UTSW 1 161046928 missense probably benign 0.00
R1365:Dars2 UTSW 1 161044994 nonsense probably null
R1502:Dars2 UTSW 1 161046805 nonsense probably null
R1625:Dars2 UTSW 1 161054044 missense possibly damaging 0.88
R1934:Dars2 UTSW 1 161063241 splice site probably null
R2239:Dars2 UTSW 1 161063282 missense possibly damaging 0.83
R3721:Dars2 UTSW 1 161063308 missense probably benign 0.03
R4308:Dars2 UTSW 1 161041721 missense probably damaging 0.98
R4786:Dars2 UTSW 1 161060760 missense probably damaging 1.00
R4859:Dars2 UTSW 1 161044990 missense probably damaging 0.99
R4903:Dars2 UTSW 1 161051371 missense probably benign 0.06
R5042:Dars2 UTSW 1 161045094 intron probably benign
R5068:Dars2 UTSW 1 161041913 missense probably benign 0.02
R6257:Dars2 UTSW 1 161041828 missense probably damaging 1.00
R7286:Dars2 UTSW 1 161046808 missense possibly damaging 0.85
R7346:Dars2 UTSW 1 161046772 splice site probably null
R7444:Dars2 UTSW 1 161046884 missense possibly damaging 0.94
R7593:Dars2 UTSW 1 161057543 missense probably damaging 1.00
R7845:Dars2 UTSW 1 161041748 missense probably benign 0.00
X0063:Dars2 UTSW 1 161056493 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- GACCTCCCATCAAATGCTGTGTAAGAA -3'
(R):5'- ccaactgagTGATTTCCCCTGCTCTAT -3'

Sequencing Primer
(F):5'- gcatcatagtctacacctgtaacc -3'
(R):5'- tgtccatcgtgtgtagcag -3'
Posted On2013-06-12