Incidental Mutation 'R0537:Dnajc1'
ID49484
Institutional Source Beutler Lab
Gene Symbol Dnajc1
Ensembl Gene ENSMUSG00000026740
Gene NameDnaJ heat shock protein family (Hsp40) member C1
Synonyms4733401K02Rik, MTJ1, Dnajl1, D230036H06Rik, ERdj1
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location18195654-18392830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18307956 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 194 (S194R)
Ref Sequence ENSEMBL: ENSMUSP00000126321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028072] [ENSMUST00000091418] [ENSMUST00000166495]
Predicted Effect probably benign
Transcript: ENSMUST00000028072
SMART Domains Protein: ENSMUSP00000028072
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 104 5.4e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000091418
AA Change: S194R

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088980
Gene: ENSMUSG00000026740
AA Change: S194R

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153055
Predicted Effect probably benign
Transcript: ENSMUST00000163130
SMART Domains Protein: ENSMUSP00000129176
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
DnaJ 34 78 5.4e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164606
Predicted Effect probably benign
Transcript: ENSMUST00000164835
Predicted Effect possibly damaging
Transcript: ENSMUST00000166495
AA Change: S194R

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126321
Gene: ENSMUSG00000026740
AA Change: S194R

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168723
SMART Domains Protein: ENSMUSP00000126716
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
SANT 129 180 2.06e-6 SMART
low complexity region 221 239 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
SANT 296 348 3.56e-10 SMART
Meta Mutation Damage Score 0.1443 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a DNAJ-like heat shock protein that binds the molecular chaperone BiP. In addition, the encoded protein contains two SANT domains that have been shown to bind serpin alpha1-antichymotrypsin and inter-alpha trypsin inhibitor heavy chain 4. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Dnajc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dnajc1 APN 2 18308902 missense possibly damaging 0.80
IGL01301:Dnajc1 APN 2 18308834 missense probably damaging 0.99
IGL02080:Dnajc1 APN 2 18316348 intron probably benign
IGL03058:Dnajc1 APN 2 18217321 missense possibly damaging 0.90
ANU18:Dnajc1 UTSW 2 18308834 missense probably damaging 0.99
R0630:Dnajc1 UTSW 2 18231801 missense probably damaging 1.00
R1187:Dnajc1 UTSW 2 18284709 missense probably benign 0.01
R1511:Dnajc1 UTSW 2 18222727 missense possibly damaging 0.88
R1844:Dnajc1 UTSW 2 18294027 nonsense probably null
R1848:Dnajc1 UTSW 2 18219713 missense probably damaging 1.00
R2174:Dnajc1 UTSW 2 18307951 missense probably damaging 0.99
R2199:Dnajc1 UTSW 2 18308899 missense probably damaging 1.00
R2211:Dnajc1 UTSW 2 18392475 missense probably damaging 0.99
R2471:Dnajc1 UTSW 2 18219816 missense possibly damaging 0.75
R4758:Dnajc1 UTSW 2 18308946 nonsense probably null
R5790:Dnajc1 UTSW 2 18307087 intron probably benign
R5802:Dnajc1 UTSW 2 18284739 missense probably benign 0.41
R5950:Dnajc1 UTSW 2 18306941 intron probably benign
R6049:Dnajc1 UTSW 2 18231700 splice site probably null
R6770:Dnajc1 UTSW 2 18217271 unclassified probably benign
R7242:Dnajc1 UTSW 2 18293972 missense probably benign 0.06
R7462:Dnajc1 UTSW 2 18308899 missense probably damaging 0.99
R7716:Dnajc1 UTSW 2 18219873 missense probably benign 0.00
R7846:Dnajc1 UTSW 2 18219893 missense possibly damaging 0.56
R7963:Dnajc1 UTSW 2 18222724 missense possibly damaging 0.66
Z1176:Dnajc1 UTSW 2 18293987 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCTGAAGCAGTGCTCACTAACTC -3'
(R):5'- TGGAGATGCACATGACTGACAATGC -3'

Sequencing Primer
(F):5'- GAACTACAAGACTTTGAGAGATTGC -3'
(R):5'- CATGTGTCTATGAGGCCAGATACC -3'
Posted On2013-06-12