Incidental Mutation 'R0537:Olfr1140'
ID49487
Institutional Source Beutler Lab
Gene Symbol Olfr1140
Ensembl Gene ENSMUSG00000068817
Gene Nameolfactory receptor 1140
SynonymsMOR177-6, GA_x6K02T2Q125-49250025-49250960
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87743752-87747581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87746673 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 159 (Q159L)
Ref Sequence ENSEMBL: ENSMUSP00000149645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111568] [ENSMUST00000214723] [ENSMUST00000217572]
Predicted Effect probably benign
Transcript: ENSMUST00000111568
AA Change: Q159L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107194
Gene: ENSMUSG00000068815
AA Change: Q159L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-44 PFAM
Pfam:7tm_1 41 290 2.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214723
AA Change: Q159L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217102
Predicted Effect probably benign
Transcript: ENSMUST00000217572
AA Change: Q159L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217634
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Olfr1140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1140 APN 2 87747125 missense probably benign 0.03
IGL01538:Olfr1140 APN 2 87746598 missense probably benign 0.10
IGL01735:Olfr1140 APN 2 87746306 missense probably benign 0.00
IGL02224:Olfr1140 APN 2 87746413 nonsense probably null
IGL03047:Olfr1140 UTSW 2 87746994 missense possibly damaging 0.63
R1701:Olfr1140 UTSW 2 87746550 missense probably damaging 0.99
R1998:Olfr1140 UTSW 2 87746972 missense probably damaging 1.00
R2430:Olfr1140 UTSW 2 87746655 missense possibly damaging 0.52
R4750:Olfr1140 UTSW 2 87746508 missense probably benign
R5048:Olfr1140 UTSW 2 87746319 missense probably benign 0.01
R5494:Olfr1140 UTSW 2 87746606 missense probably damaging 1.00
R5521:Olfr1140 UTSW 2 87747062 missense probably benign 0.24
R7786:Olfr1140 UTSW 2 87746301 missense probably damaging 1.00
R8017:Olfr1140 UTSW 2 87747048 missense probably damaging 0.98
R8019:Olfr1140 UTSW 2 87747048 missense probably damaging 0.98
X0019:Olfr1140 UTSW 2 87746420 missense possibly damaging 0.96
Z1088:Olfr1140 UTSW 2 87746489 missense probably damaging 0.99
Z1177:Olfr1140 UTSW 2 87746624 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ACTGCTGTTGGACCAAAGATGCTG -3'
(R):5'- CAGGCTGTAAATCAGAGGGTTGAGC -3'

Sequencing Primer
(F):5'- CACAAATCTTTATCTTTTTTGGGCTG -3'
(R):5'- GCTGATCTTCAAGACTGATGC -3'
Posted On2013-06-12