Incidental Mutation 'R0537:Acot11'
ID49491
Institutional Source Beutler Lab
Gene Symbol Acot11
Ensembl Gene ENSMUSG00000034853
Gene Nameacyl-CoA thioesterase 11
SynonymsThea, Them1, 2010309H15Rik, 1110020M10Rik, BFIT1
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R0537 (G1)
Quality Score162
Status Validated
Chromosome4
Chromosomal Location106744555-106804998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106762455 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 156 (E156G)
Ref Sequence ENSEMBL: ENSMUSP00000099823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065253] [ENSMUST00000102762] [ENSMUST00000140541] [ENSMUST00000145061] [ENSMUST00000148688] [ENSMUST00000156567]
Predicted Effect probably benign
Transcript: ENSMUST00000065253
AA Change: E176G

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069636
Gene: ENSMUSG00000034853
AA Change: E176G

DomainStartEndE-ValueType
Pfam:4HBT 84 157 7e-10 PFAM
Pfam:4HBT 255 331 2.6e-13 PFAM
START 405 603 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102762
AA Change: E156G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099823
Gene: ENSMUSG00000034853
AA Change: E156G

DomainStartEndE-ValueType
Pfam:4HBT 64 136 7.2e-10 PFAM
Pfam:4HBT 235 311 6.7e-13 PFAM
START 385 583 1.49e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140541
SMART Domains Protein: ENSMUSP00000124567
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 32 71 3e-10 PDB
SCOP:d1lo7a_ 37 69 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145061
SMART Domains Protein: ENSMUSP00000125123
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
Pfam:4HBT 49 107 4.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148688
SMART Domains Protein: ENSMUSP00000124385
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 28 93 6e-23 PDB
SCOP:d1lo7a_ 33 93 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156567
SMART Domains Protein: ENSMUSP00000123942
Gene: ENSMUSG00000034853

DomainStartEndE-ValueType
PDB:3B7K|C 43 89 8e-11 PDB
SCOP:d1lo7a_ 48 80 2e-3 SMART
Meta Mutation Damage Score 0.0729 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-CoA thioesterase family which catalyse the conversion of activated fatty acids to the corresponding non-esterified fatty acid and coenzyme A. Expression of a mouse homolog in brown adipose tissue is induced by low temperatures and repressed by warm temperatures. Higher levels of expression of the mouse homolog has been found in obesity-resistant mice compared with obesity-prone mice, suggesting a role of acyl-CoA thioesterase 11 in obesity. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a null mutation display resistance to high fat diet induced obesity, inflammation and hepatic steatosis, increased energy expenditure, increased brown adipose tissue amount, and increased food intake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Acot11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Acot11 APN 4 106771484 missense probably benign 0.00
IGL01896:Acot11 APN 4 106771367 missense probably damaging 1.00
IGL02408:Acot11 APN 4 106758381 missense probably damaging 1.00
IGL03053:Acot11 APN 4 106755853 nonsense probably null
IGL03156:Acot11 APN 4 106754136 missense probably damaging 1.00
R0266:Acot11 UTSW 4 106749988 missense probably damaging 0.99
R0485:Acot11 UTSW 4 106762027 missense probably damaging 1.00
R0707:Acot11 UTSW 4 106760132 missense probably damaging 1.00
R0969:Acot11 UTSW 4 106760080 critical splice donor site probably null
R1109:Acot11 UTSW 4 106749348 missense probably benign 0.01
R1785:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1786:Acot11 UTSW 4 106762035 missense probably damaging 1.00
R1965:Acot11 UTSW 4 106749353 missense probably damaging 1.00
R2076:Acot11 UTSW 4 106770713 missense probably damaging 0.99
R2509:Acot11 UTSW 4 106755319 missense possibly damaging 0.90
R4558:Acot11 UTSW 4 106748366 missense probably damaging 1.00
R4565:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4567:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4847:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R4881:Acot11 UTSW 4 106755305 critical splice donor site probably null
R5234:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5235:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5409:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5430:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5518:Acot11 UTSW 4 106750010 missense probably benign 0.24
R5763:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5787:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5788:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5933:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R5934:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6093:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6104:Acot11 UTSW 4 106755897 missense probably damaging 1.00
R6726:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6727:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6728:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R6734:Acot11 UTSW 4 106760130 missense probably damaging 1.00
R7242:Acot11 UTSW 4 106762493 missense probably benign 0.00
R7257:Acot11 UTSW 4 106758402 missense probably damaging 1.00
R7360:Acot11 UTSW 4 106749351 missense possibly damaging 0.94
R8125:Acot11 UTSW 4 106760080 critical splice donor site probably null
R8393:Acot11 UTSW 4 106760193 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CAAGTTCCCAGAGACAGCACAGTG -3'
(R):5'- AGCCTCCCTAAAGTTGCAAGCC -3'

Sequencing Primer
(F):5'- GACAGGGCATAGTCCTCTCTAAATG -3'
(R):5'- AGTTGCAAGCCTTGAGTCAC -3'
Posted On2013-06-12