Incidental Mutation 'R0537:Tmem168'
ID49494
Institutional Source Beutler Lab
Gene Symbol Tmem168
Ensembl Gene ENSMUSG00000029569
Gene Nametransmembrane protein 168
Synonyms5730526F17Rik, 8430437G11Rik
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location13580687-13608100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 13603361 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 2 (C2F)
Ref Sequence ENSEMBL: ENSMUSP00000031554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031554] [ENSMUST00000149123]
Predicted Effect probably damaging
Transcript: ENSMUST00000031554
AA Change: C2F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031554
Gene: ENSMUSG00000029569
AA Change: C2F

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
transmembrane domain 63 85 N/A INTRINSIC
transmembrane domain 92 109 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
transmembrane domain 170 192 N/A INTRINSIC
transmembrane domain 199 216 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
transmembrane domain 298 320 N/A INTRINSIC
transmembrane domain 359 378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146139
Predicted Effect probably benign
Transcript: ENSMUST00000149123
SMART Domains Protein: ENSMUSP00000145372
Gene: ENSMUSG00000029569

DomainStartEndE-ValueType
SCOP:d1jxqa_ 29 167 8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155179
Meta Mutation Damage Score 0.2317 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Tmem168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Tmem168 APN 6 13602675 missense probably benign 0.06
IGL01305:Tmem168 APN 6 13583046 missense probably damaging 1.00
IGL01843:Tmem168 APN 6 13582941 missense probably damaging 1.00
IGL02742:Tmem168 APN 6 13603262 missense probably benign 0.04
IGL02863:Tmem168 APN 6 13582918 missense probably damaging 0.98
ANU22:Tmem168 UTSW 6 13583046 missense probably damaging 1.00
R0193:Tmem168 UTSW 6 13583313 missense possibly damaging 0.81
R0630:Tmem168 UTSW 6 13583065 missense probably benign
R0890:Tmem168 UTSW 6 13603272 missense probably damaging 1.00
R1416:Tmem168 UTSW 6 13591401 missense probably damaging 0.96
R1900:Tmem168 UTSW 6 13583071 missense probably benign 0.02
R3947:Tmem168 UTSW 6 13583052 missense probably damaging 1.00
R4362:Tmem168 UTSW 6 13595073 missense probably benign 0.31
R4620:Tmem168 UTSW 6 13594953 missense probably benign 0.03
R5693:Tmem168 UTSW 6 13602321 missense probably benign 0.01
R6142:Tmem168 UTSW 6 13591369 missense probably benign
R6328:Tmem168 UTSW 6 13602711 missense probably benign
R6438:Tmem168 UTSW 6 13602674 missense probably benign 0.06
R6711:Tmem168 UTSW 6 13603121 missense probably damaging 1.00
R6827:Tmem168 UTSW 6 13582838 missense probably damaging 0.99
R6987:Tmem168 UTSW 6 13591477 missense possibly damaging 0.82
R7696:Tmem168 UTSW 6 13602938 missense probably benign 0.01
R8295:Tmem168 UTSW 6 13602851 missense probably damaging 0.99
R8344:Tmem168 UTSW 6 13583325 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGACTTAAACTGGCTGCTTCCATTG -3'
(R):5'- GATCACGGGCATTTTCCTTTGTGTAAC -3'

Sequencing Primer
(F):5'- CTGGCTGCTTCCATTGAAAAG -3'
(R):5'- TGCAATTAGGATTTGAACTGGACG -3'
Posted On2013-06-12