Incidental Mutation 'R0537:Try4'
ID49495
Institutional Source Beutler Lab
Gene Symbol Try4
Ensembl Gene ENSMUSG00000054106
Gene Nametrypsin 4
Synonyms0910001B19Rik, Td
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41302269-41305532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41304362 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 79 (N79K)
Ref Sequence ENSEMBL: ENSMUSP00000031913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031913]
Predicted Effect probably benign
Transcript: ENSMUST00000031913
AA Change: N79K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031913
Gene: ENSMUSG00000054106
AA Change: N79K

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Tryp_SPc 23 239 9.72e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193013
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Try4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Try4 APN 6 41305026 missense probably damaging 1.00
IGL02216:Try4 APN 6 41305031 missense probably benign
R0731:Try4 UTSW 6 41304367 missense probably benign 0.01
R1113:Try4 UTSW 6 41305374 missense possibly damaging 0.90
R1833:Try4 UTSW 6 41303431 missense probably damaging 0.98
R2246:Try4 UTSW 6 41305472 missense possibly damaging 0.80
R4131:Try4 UTSW 6 41305401 nonsense probably null
R4414:Try4 UTSW 6 41304971 missense possibly damaging 0.84
R5457:Try4 UTSW 6 41303421 missense probably damaging 1.00
R5707:Try4 UTSW 6 41305043 missense possibly damaging 0.65
R6023:Try4 UTSW 6 41303421 missense probably damaging 1.00
R7131:Try4 UTSW 6 41304403 missense probably benign 0.03
R7783:Try4 UTSW 6 41302295 missense possibly damaging 0.96
R8051:Try4 UTSW 6 41305062 missense probably damaging 0.99
RF007:Try4 UTSW 6 41305363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGAGATGCCACAGTTACAGGG -3'
(R):5'- AGAGATGAGACACTGAGTGCCTGC -3'

Sequencing Primer
(F):5'- GAGTTGATGAGCAGTCATTCACC -3'
(R):5'- ATGTCGTTGTTCAGGGTCCT -3'
Posted On2013-06-12