Incidental Mutation 'R0537:Pold1'
ID49500
Institutional Source Beutler Lab
Gene Symbol Pold1
Ensembl Gene ENSMUSG00000038644
Gene Namepolymerase (DNA directed), delta 1, catalytic subunit
Synonyms125kDa
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R0537 (G1)
Quality Score168
Status Validated
Chromosome7
Chromosomal Location44532746-44548849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44535092 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 828 (E828G)
Ref Sequence ENSEMBL: ENSMUSP00000117157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035323] [ENSMUST00000049343] [ENSMUST00000098483] [ENSMUST00000151793] [ENSMUST00000205506]
Predicted Effect probably benign
Transcript: ENSMUST00000035323
SMART Domains Protein: ENSMUSP00000035539
Gene: ENSMUSG00000008193

DomainStartEndE-ValueType
low complexity region 50 58 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
ETS 173 261 2.05e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049343
AA Change: E828G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644
AA Change: E828G

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098483
SMART Domains Protein: ENSMUSP00000096084
Gene: ENSMUSG00000008193

DomainStartEndE-ValueType
low complexity region 68 76 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
ETS 191 279 2.05e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147503
Predicted Effect probably damaging
Transcript: ENSMUST00000151793
AA Change: E828G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644
AA Change: E828G

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184044
Predicted Effect probably benign
Transcript: ENSMUST00000205506
Meta Mutation Damage Score 0.9353 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have an elevated mutation rate as well as an increased incidence of tumors. Median age for these mice is around 10 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Pold1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Pold1 APN 7 44543232 splice site probably benign
IGL01626:Pold1 APN 7 44533372 critical splice donor site probably null
IGL01635:Pold1 APN 7 44535977 missense probably damaging 1.00
IGL02165:Pold1 APN 7 44538060 missense probably damaging 1.00
IGL02197:Pold1 APN 7 44542239 missense probably benign 0.07
IGL02579:Pold1 APN 7 44543279 missense probably damaging 1.00
IGL03104:Pold1 APN 7 44540580 missense probably damaging 1.00
IGL03118:Pold1 APN 7 44539400 missense probably benign 0.17
PIT4243001:Pold1 UTSW 7 44542158 missense possibly damaging 0.77
PIT4431001:Pold1 UTSW 7 44538894 missense probably damaging 1.00
R0184:Pold1 UTSW 7 44541715 missense probably benign 0.32
R0266:Pold1 UTSW 7 44541025 splice site probably benign
R1251:Pold1 UTSW 7 44535051 missense probably benign 0.02
R1348:Pold1 UTSW 7 44534682 missense probably benign 0.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1376:Pold1 UTSW 7 44540562 missense probably damaging 1.00
R1445:Pold1 UTSW 7 44542757 splice site probably benign
R2156:Pold1 UTSW 7 44539118 missense probably damaging 1.00
R2256:Pold1 UTSW 7 44533799 critical splice acceptor site probably null
R2259:Pold1 UTSW 7 44541484 splice site probably benign
R2870:Pold1 UTSW 7 44543347 synonymous silent
R3793:Pold1 UTSW 7 44541570 missense probably damaging 1.00
R4493:Pold1 UTSW 7 44537708 missense probably damaging 1.00
R4583:Pold1 UTSW 7 44538913 missense probably damaging 0.97
R4661:Pold1 UTSW 7 44532809 missense probably damaging 0.99
R4738:Pold1 UTSW 7 44541329 missense probably damaging 0.99
R4769:Pold1 UTSW 7 44535071 missense probably damaging 1.00
R4797:Pold1 UTSW 7 44541901 missense possibly damaging 0.91
R5009:Pold1 UTSW 7 44533902 missense probably benign 0.13
R5150:Pold1 UTSW 7 44535832 missense possibly damaging 0.91
R5534:Pold1 UTSW 7 44538619 missense probably damaging 1.00
R5988:Pold1 UTSW 7 44540580 missense probably damaging 1.00
R6113:Pold1 UTSW 7 44537700 missense probably damaging 1.00
R6127:Pold1 UTSW 7 44542121 missense probably damaging 1.00
R6232:Pold1 UTSW 7 44540842 critical splice donor site probably null
R6435:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6436:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6437:Pold1 UTSW 7 44538778 missense probably damaging 1.00
R6930:Pold1 UTSW 7 44542206 missense probably benign
R7049:Pold1 UTSW 7 44541371 missense possibly damaging 0.95
R7158:Pold1 UTSW 7 44538866 missense probably damaging 1.00
R7170:Pold1 UTSW 7 44542148 missense possibly damaging 0.93
R7235:Pold1 UTSW 7 44541820 missense probably benign 0.00
R7372:Pold1 UTSW 7 44543423 missense possibly damaging 0.59
R7511:Pold1 UTSW 7 44542190 missense possibly damaging 0.67
R7797:Pold1 UTSW 7 44541789 missense probably benign 0.00
Z1176:Pold1 UTSW 7 44541780 missense probably benign 0.15
Z1176:Pold1 UTSW 7 44542232 missense probably benign
Z1177:Pold1 UTSW 7 44541958 missense not run
Predicted Primers PCR Primer
(F):5'- GGGATGGGGATGCAACTTTTACCAG -3'
(R):5'- TTCATAATTTCGGGGCCAGCCTTAG -3'

Sequencing Primer
(F):5'- AGGATCTAGGCATCTTGCAC -3'
(R):5'- GGCCTATGGCATTATGTCAAG -3'
Posted On2013-06-12