Incidental Mutation 'R0537:Pold1'
ID 49500
Institutional Source Beutler Lab
Gene Symbol Pold1
Ensembl Gene ENSMUSG00000038644
Gene Name polymerase (DNA directed), delta 1, catalytic subunit
Synonyms 125kDa
MMRRC Submission 038729-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.968) question?
Stock # R0537 (G1)
Quality Score 168
Status Validated
Chromosome 7
Chromosomal Location 44182168-44198239 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44184516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 828 (E828G)
Ref Sequence ENSEMBL: ENSMUSP00000117157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035323] [ENSMUST00000049343] [ENSMUST00000098483] [ENSMUST00000151793] [ENSMUST00000205506]
AlphaFold P52431
Predicted Effect probably benign
Transcript: ENSMUST00000035323
SMART Domains Protein: ENSMUSP00000035539
Gene: ENSMUSG00000008193

DomainStartEndE-ValueType
low complexity region 50 58 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
ETS 173 261 2.05e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049343
AA Change: E828G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644
AA Change: E828G

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098483
SMART Domains Protein: ENSMUSP00000096084
Gene: ENSMUSG00000008193

DomainStartEndE-ValueType
low complexity region 68 76 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
ETS 191 279 2.05e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147503
Predicted Effect probably damaging
Transcript: ENSMUST00000151793
AA Change: E828G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644
AA Change: E828G

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154783
Predicted Effect probably benign
Transcript: ENSMUST00000205506
Meta Mutation Damage Score 0.9353 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 125-kDa catalytic subunit of DNA polymerase delta. DNA polymerase delta possesses both polymerase and 3' to 5' exonuclease activity and plays a critical role in DNA replication and repair. Alternatively spliced transcript variants have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene have an elevated mutation rate as well as an increased incidence of tumors. Median age for these mice is around 10 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 35,818,657 (GRCm39) K218N probably benign Het
Acot11 T C 4: 106,619,652 (GRCm39) E156G probably benign Het
Arhgef28 A T 13: 98,094,224 (GRCm39) N973K probably damaging Het
B4galt3 T C 1: 171,101,821 (GRCm39) probably benign Het
Bmpr1a T C 14: 34,165,769 (GRCm39) probably benign Het
Camkmt A T 17: 85,702,087 (GRCm39) I184F probably benign Het
Ccdc33 T C 9: 58,024,737 (GRCm39) Y163C probably damaging Het
Ccdc9 A G 7: 16,014,701 (GRCm39) probably benign Het
Dars2 A T 1: 160,888,318 (GRCm39) C201S possibly damaging Het
Dnajc1 A T 2: 18,312,767 (GRCm39) S194R possibly damaging Het
Dock8 A G 19: 25,148,941 (GRCm39) D1473G probably benign Het
Dpm2 T A 2: 32,462,961 (GRCm39) probably null Het
Dsg4 T C 18: 20,591,628 (GRCm39) S456P probably damaging Het
Gys1 T C 7: 45,089,425 (GRCm39) S195P probably damaging Het
Heatr6 G T 11: 83,670,290 (GRCm39) E948* probably null Het
Itgal G A 7: 126,910,445 (GRCm39) R518Q possibly damaging Het
Klhdc8b G C 9: 108,326,422 (GRCm39) R158G possibly damaging Het
Klhl41 G A 2: 69,500,554 (GRCm39) R5Q probably benign Het
Lrrtm4 A T 6: 79,999,103 (GRCm39) T172S probably benign Het
Lypd1 A G 1: 125,840,604 (GRCm39) probably benign Het
Mei1 T C 15: 81,975,562 (GRCm39) F121S possibly damaging Het
Mtor C T 4: 148,622,817 (GRCm39) R1966W probably damaging Het
Myh7 A G 14: 55,228,256 (GRCm39) F247L possibly damaging Het
Nebl G T 2: 17,409,026 (GRCm39) D392E possibly damaging Het
Notch2 C A 3: 98,024,057 (GRCm39) N840K possibly damaging Het
Nubp1 T C 16: 10,240,678 (GRCm39) probably benign Het
Or5w16 A T 2: 87,577,017 (GRCm39) Q159L probably benign Het
Or7g19 T C 9: 18,856,444 (GRCm39) S167P probably damaging Het
Pcdh17 T A 14: 84,684,897 (GRCm39) S455T probably damaging Het
Picalm C A 7: 89,779,876 (GRCm39) H32Q probably benign Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rala A T 13: 18,063,233 (GRCm39) N119K probably benign Het
Rasal2 A T 1: 156,975,362 (GRCm39) V1149E possibly damaging Het
Rd3 A G 1: 191,715,501 (GRCm39) Y92C probably damaging Het
Rps18-ps6 A T 13: 97,897,071 (GRCm39) F9Y probably benign Het
Sart1 A T 19: 5,431,752 (GRCm39) D635E probably damaging Het
Sec16b A G 1: 157,365,116 (GRCm39) T335A possibly damaging Het
Slc11a2 C T 15: 100,303,679 (GRCm39) G185R probably damaging Het
Slc2a12 G A 10: 22,540,967 (GRCm39) R274H probably damaging Het
Spag17 T C 3: 100,032,618 (GRCm39) V2276A probably damaging Het
Tcam1 G A 11: 106,174,904 (GRCm39) E120K probably benign Het
Tenm2 T C 11: 36,054,557 (GRCm39) D601G probably damaging Het
Tmem168 C A 6: 13,603,360 (GRCm39) C2F probably damaging Het
Tmem80 A G 7: 140,913,609 (GRCm39) Y13C probably damaging Het
Try4 T A 6: 41,281,296 (GRCm39) N79K probably benign Het
Vldlr C A 19: 27,225,318 (GRCm39) N798K probably damaging Het
Wdr41 A G 13: 95,131,813 (GRCm39) probably benign Het
Zfp30 A T 7: 29,492,160 (GRCm39) E138V probably damaging Het
Zfp366 A C 13: 99,365,786 (GRCm39) T316P probably damaging Het
Zfp563 A T 17: 33,323,659 (GRCm39) S85C possibly damaging Het
Znfx1 T C 2: 166,883,621 (GRCm39) H162R probably damaging Het
Other mutations in Pold1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Pold1 APN 7 44,192,656 (GRCm39) splice site probably benign
IGL01626:Pold1 APN 7 44,182,796 (GRCm39) critical splice donor site probably null
IGL01635:Pold1 APN 7 44,185,401 (GRCm39) missense probably damaging 1.00
IGL02165:Pold1 APN 7 44,187,484 (GRCm39) missense probably damaging 1.00
IGL02197:Pold1 APN 7 44,191,663 (GRCm39) missense probably benign 0.07
IGL02579:Pold1 APN 7 44,192,703 (GRCm39) missense probably damaging 1.00
IGL03104:Pold1 APN 7 44,190,004 (GRCm39) missense probably damaging 1.00
IGL03118:Pold1 APN 7 44,188,824 (GRCm39) missense probably benign 0.17
PIT4243001:Pold1 UTSW 7 44,191,582 (GRCm39) missense possibly damaging 0.77
PIT4431001:Pold1 UTSW 7 44,188,318 (GRCm39) missense probably damaging 1.00
R0184:Pold1 UTSW 7 44,191,139 (GRCm39) missense probably benign 0.32
R0266:Pold1 UTSW 7 44,190,449 (GRCm39) splice site probably benign
R1251:Pold1 UTSW 7 44,184,475 (GRCm39) missense probably benign 0.02
R1348:Pold1 UTSW 7 44,184,106 (GRCm39) missense probably benign 0.00
R1376:Pold1 UTSW 7 44,189,986 (GRCm39) missense probably damaging 1.00
R1376:Pold1 UTSW 7 44,189,986 (GRCm39) missense probably damaging 1.00
R1445:Pold1 UTSW 7 44,192,181 (GRCm39) splice site probably benign
R2156:Pold1 UTSW 7 44,188,542 (GRCm39) missense probably damaging 1.00
R2256:Pold1 UTSW 7 44,183,223 (GRCm39) critical splice acceptor site probably null
R2259:Pold1 UTSW 7 44,190,908 (GRCm39) splice site probably benign
R2870:Pold1 UTSW 7 44,192,771 (GRCm39) synonymous silent
R3793:Pold1 UTSW 7 44,190,994 (GRCm39) missense probably damaging 1.00
R4493:Pold1 UTSW 7 44,187,132 (GRCm39) missense probably damaging 1.00
R4583:Pold1 UTSW 7 44,188,337 (GRCm39) missense probably damaging 0.97
R4661:Pold1 UTSW 7 44,182,233 (GRCm39) missense probably damaging 0.99
R4738:Pold1 UTSW 7 44,190,753 (GRCm39) missense probably damaging 0.99
R4769:Pold1 UTSW 7 44,184,495 (GRCm39) missense probably damaging 1.00
R4797:Pold1 UTSW 7 44,191,325 (GRCm39) missense possibly damaging 0.91
R5009:Pold1 UTSW 7 44,183,326 (GRCm39) missense probably benign 0.13
R5150:Pold1 UTSW 7 44,185,256 (GRCm39) missense possibly damaging 0.91
R5534:Pold1 UTSW 7 44,188,043 (GRCm39) missense probably damaging 1.00
R5988:Pold1 UTSW 7 44,190,004 (GRCm39) missense probably damaging 1.00
R6113:Pold1 UTSW 7 44,187,124 (GRCm39) missense probably damaging 1.00
R6127:Pold1 UTSW 7 44,191,545 (GRCm39) missense probably damaging 1.00
R6232:Pold1 UTSW 7 44,190,266 (GRCm39) critical splice donor site probably null
R6435:Pold1 UTSW 7 44,188,202 (GRCm39) missense probably damaging 1.00
R6436:Pold1 UTSW 7 44,188,202 (GRCm39) missense probably damaging 1.00
R6437:Pold1 UTSW 7 44,188,202 (GRCm39) missense probably damaging 1.00
R6930:Pold1 UTSW 7 44,191,630 (GRCm39) missense probably benign
R7049:Pold1 UTSW 7 44,190,795 (GRCm39) missense possibly damaging 0.95
R7158:Pold1 UTSW 7 44,188,290 (GRCm39) missense probably damaging 1.00
R7170:Pold1 UTSW 7 44,191,572 (GRCm39) missense possibly damaging 0.93
R7235:Pold1 UTSW 7 44,191,244 (GRCm39) missense probably benign 0.00
R7372:Pold1 UTSW 7 44,192,847 (GRCm39) missense possibly damaging 0.59
R7511:Pold1 UTSW 7 44,191,614 (GRCm39) missense possibly damaging 0.67
R7797:Pold1 UTSW 7 44,191,213 (GRCm39) missense probably benign 0.00
R9037:Pold1 UTSW 7 44,188,339 (GRCm39) missense probably damaging 1.00
R9479:Pold1 UTSW 7 44,191,079 (GRCm39) missense probably damaging 1.00
Z1176:Pold1 UTSW 7 44,191,656 (GRCm39) missense probably benign
Z1176:Pold1 UTSW 7 44,191,204 (GRCm39) missense probably benign 0.15
Z1177:Pold1 UTSW 7 44,191,382 (GRCm39) missense not run
Predicted Primers PCR Primer
(F):5'- GGGATGGGGATGCAACTTTTACCAG -3'
(R):5'- TTCATAATTTCGGGGCCAGCCTTAG -3'

Sequencing Primer
(F):5'- AGGATCTAGGCATCTTGCAC -3'
(R):5'- GGCCTATGGCATTATGTCAAG -3'
Posted On 2013-06-12