Incidental Mutation 'R0537:Picalm'
ID49502
Institutional Source Beutler Lab
Gene Symbol Picalm
Ensembl Gene ENSMUSG00000039361
Gene Namephosphatidylinositol binding clathrin assembly protein
Synonymsfit-1, fit1
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location90130213-90213465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90130668 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 32 (H32Q)
Ref Sequence ENSEMBL: ENSMUSP00000146386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049537] [ENSMUST00000207225] [ENSMUST00000207484] [ENSMUST00000208684] [ENSMUST00000208730] [ENSMUST00000208742] [ENSMUST00000209068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049537
AA Change: H32Q

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051092
Gene: ENSMUSG00000039361
AA Change: H32Q

DomainStartEndE-ValueType
ENTH 20 145 2.42e-39 SMART
coiled coil region 317 349 N/A INTRINSIC
low complexity region 378 387 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207197
Predicted Effect probably benign
Transcript: ENSMUST00000207225
AA Change: H32Q

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000207484
AA Change: H32Q

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207949
Predicted Effect probably benign
Transcript: ENSMUST00000208684
Predicted Effect probably benign
Transcript: ENSMUST00000208730
AA Change: H32Q

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000208742
AA Change: H32Q

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000209068
AA Change: H32Q

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209166
Meta Mutation Damage Score 0.2772 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a clathrin assembly protein, which recruits clathrin and adaptor protein complex 2 (AP2) to cell membranes at sites of coated-pit formation and clathrin-vesicle assembly. The protein may be required to determine the amount of membrane to be recycled, possibly by regulating the size of the clathrin cage. The protein is involved in AP2-dependent clathrin-mediated endocytosis at the neuromuscular junction. A chromosomal translocation t(10;11)(p13;q14) leading to the fusion of this gene and the MLLT10 gene is found in acute lymphoblastic leukemia, acute myeloid leukemia and malignant lymphomas. The polymorphisms of this gene are associated with the risk of Alzheimer disease. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for different ENU-induced mutations or knock-out alleles are small, runted and display anemia of variable severity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Picalm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Picalm APN 7 90161318 missense probably damaging 1.00
IGL01147:Picalm APN 7 90177592 missense probably benign 0.42
IGL02814:Picalm APN 7 90191749 missense possibly damaging 0.75
IGL02828:Picalm APN 7 90177501 missense probably benign
IGL02904:Picalm APN 7 90176411 splice site probably benign
IGL02986:Picalm APN 7 90207585 missense probably benign 0.00
IGL03001:Picalm APN 7 90182246 missense probably benign 0.00
IGL03247:Picalm APN 7 90194291 missense probably benign 0.27
R0024:Picalm UTSW 7 90130704 critical splice donor site probably null
R0085:Picalm UTSW 7 90182317 missense probably benign
R0414:Picalm UTSW 7 90189198 missense possibly damaging 0.94
R0855:Picalm UTSW 7 90191148 missense possibly damaging 0.55
R1269:Picalm UTSW 7 90165549 nonsense probably null
R1496:Picalm UTSW 7 90130651 missense probably benign 0.36
R1635:Picalm UTSW 7 90191251 missense probably damaging 1.00
R1750:Picalm UTSW 7 90191182 missense possibly damaging 0.81
R1755:Picalm UTSW 7 90160549 missense possibly damaging 0.88
R2513:Picalm UTSW 7 90197009 missense probably damaging 1.00
R3850:Picalm UTSW 7 90191704 missense probably damaging 1.00
R3874:Picalm UTSW 7 90189219 missense probably damaging 1.00
R5095:Picalm UTSW 7 90170633 missense probably damaging 1.00
R5368:Picalm UTSW 7 90207595 makesense probably null
R5517:Picalm UTSW 7 90170598 missense possibly damaging 0.68
R6012:Picalm UTSW 7 90195700 missense probably benign
R6280:Picalm UTSW 7 90177562 missense probably benign 0.00
R6739:Picalm UTSW 7 90176708 missense probably damaging 1.00
R6951:Picalm UTSW 7 90191375 missense probably damaging 1.00
R7083:Picalm UTSW 7 90176768 missense probably benign 0.01
R7877:Picalm UTSW 7 90130668 missense probably benign 0.05
R8081:Picalm UTSW 7 90191243 nonsense probably null
Z1176:Picalm UTSW 7 90196967 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCCCGGAAAGCTCCGAGGA -3'
(R):5'- CGACCAGGCACAGGAGCCAT -3'

Sequencing Primer
(F):5'- CCGACTTGGTGTGGGAGC -3'
(R):5'- CATCGTGCAGATAAGACGC -3'
Posted On2013-06-12