Incidental Mutation 'R0537:Klhdc8b'
ID49507
Institutional Source Beutler Lab
Gene Symbol Klhdc8b
Ensembl Gene ENSMUSG00000032609
Gene Namekelch domain containing 8B
Synonyms4931406O17Rik
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0537 (G1)
Quality Score190
Status Validated
Chromosome9
Chromosomal Location108447636-108461581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 108449223 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 158 (R158G)
Ref Sequence ENSEMBL: ENSMUSP00000141558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035232] [ENSMUST00000057265] [ENSMUST00000193286] [ENSMUST00000193895] [ENSMUST00000195435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035232
AA Change: R204G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035232
Gene: ENSMUSG00000032609
AA Change: R204G

DomainStartEndE-ValueType
Kelch 32 79 2.08e-6 SMART
Kelch 80 127 1.9e-1 SMART
Kelch 128 174 1.76e-4 SMART
Kelch 176 222 3.74e-8 SMART
Kelch 239 281 8.33e0 SMART
Kelch 282 329 3.83e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057265
SMART Domains Protein: ENSMUSP00000059069
Gene: ENSMUSG00000050641

DomainStartEndE-ValueType
Pfam:HDNR 3 156 1.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193159
Predicted Effect possibly damaging
Transcript: ENSMUST00000193286
AA Change: R204G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142325
Gene: ENSMUSG00000032609
AA Change: R204G

DomainStartEndE-ValueType
Kelch 32 79 2.08e-6 SMART
Kelch 80 127 1.9e-1 SMART
Kelch 128 174 1.76e-4 SMART
Kelch 176 222 3.74e-8 SMART
Kelch 239 281 8.33e0 SMART
Kelch 282 329 3.83e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193895
AA Change: R204G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141453
Gene: ENSMUSG00000032609
AA Change: R204G

DomainStartEndE-ValueType
Kelch 32 79 2.08e-6 SMART
Kelch 80 127 1.9e-1 SMART
Kelch 128 174 1.76e-4 SMART
Kelch 176 222 3.74e-8 SMART
Kelch 239 281 8.33e0 SMART
Kelch 282 329 3.83e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194633
Predicted Effect possibly damaging
Transcript: ENSMUST00000195435
AA Change: R158G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141558
Gene: ENSMUSG00000032609
AA Change: R158G

DomainStartEndE-ValueType
Kelch 32 79 7e-9 SMART
Kelch 80 127 6.3e-4 SMART
Kelch 128 176 1.5e-8 SMART
Kelch 193 235 2.8e-2 SMART
Kelch 236 283 1.3e-7 SMART
Meta Mutation Damage Score 0.1858 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which forms a distinct beta-propeller protein structure of kelch domains allowing for protein-protein interactions. Mutations in this gene have been associated with Hodgkin lymphoma. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Klhdc8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Klhdc8b APN 9 108448906 missense probably benign 0.41
R0552:Klhdc8b UTSW 9 108449223 missense possibly damaging 0.90
R1080:Klhdc8b UTSW 9 108449638 missense probably benign 0.29
R1595:Klhdc8b UTSW 9 108451163 missense probably damaging 0.99
R4976:Klhdc8b UTSW 9 108451187 missense probably damaging 1.00
R5024:Klhdc8b UTSW 9 108448985 intron probably benign
R5056:Klhdc8b UTSW 9 108448985 intron probably benign
R5327:Klhdc8b UTSW 9 108449042 intron probably benign
R5819:Klhdc8b UTSW 9 108451062 missense probably benign 0.20
R6265:Klhdc8b UTSW 9 108448425 missense probably damaging 1.00
R7420:Klhdc8b UTSW 9 108449118 missense possibly damaging 0.59
Z1176:Klhdc8b UTSW 9 108448377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACACAGACATATGCAGATGCAAG -3'
(R):5'- GCCCAACTGGGGTTGGAAAATCAC -3'

Sequencing Primer
(F):5'- acgcacgcacTCCCTTC -3'
(R):5'- CATGGTTACTCCATGAGCAGG -3'
Posted On2013-06-12