Incidental Mutation 'R0537:Heatr6'
ID49510
Institutional Source Beutler Lab
Gene Symbol Heatr6
Ensembl Gene ENSMUSG00000000976
Gene NameHEAT repeat containing 6
Synonyms
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location83753696-83783754 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 83779464 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 948 (E948*)
Ref Sequence ENSEMBL: ENSMUSP00000001002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001002]
Predicted Effect probably null
Transcript: ENSMUST00000001002
AA Change: E948*
SMART Domains Protein: ENSMUSP00000001002
Gene: ENSMUSG00000000976
AA Change: E948*

DomainStartEndE-ValueType
low complexity region 160 174 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
low complexity region 329 348 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Pfam:DUF4042 421 602 9.6e-73 PFAM
low complexity region 603 627 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 1078 1091 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136572
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Heatr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Heatr6 APN 11 83759309 missense probably damaging 1.00
IGL01681:Heatr6 APN 11 83765000 missense probably benign 0.08
IGL01905:Heatr6 APN 11 83781712 missense probably benign 0.06
IGL02037:Heatr6 APN 11 83764882 splice site probably benign
IGL02313:Heatr6 APN 11 83778892 missense probably damaging 1.00
IGL02652:Heatr6 APN 11 83769732 missense probably damaging 1.00
IGL03004:Heatr6 APN 11 83757379 missense probably benign 0.01
IGL03229:Heatr6 APN 11 83781445 missense probably benign 0.01
IGL03386:Heatr6 APN 11 83759377 missense probably damaging 1.00
IGL02802:Heatr6 UTSW 11 83760936 missense probably damaging 1.00
R1658:Heatr6 UTSW 11 83758367 missense probably damaging 1.00
R1864:Heatr6 UTSW 11 83769230 missense probably damaging 0.97
R1893:Heatr6 UTSW 11 83757314 missense probably benign 0.33
R1944:Heatr6 UTSW 11 83769220 missense probably damaging 1.00
R2115:Heatr6 UTSW 11 83757455 unclassified probably benign
R3019:Heatr6 UTSW 11 83778832 splice site probably null
R4050:Heatr6 UTSW 11 83755773 missense probably damaging 0.99
R4532:Heatr6 UTSW 11 83769672 missense probably damaging 1.00
R4576:Heatr6 UTSW 11 83765000 missense probably benign 0.08
R4724:Heatr6 UTSW 11 83779548 nonsense probably null
R4825:Heatr6 UTSW 11 83758322 missense probably damaging 1.00
R5489:Heatr6 UTSW 11 83774432 missense probably damaging 1.00
R5970:Heatr6 UTSW 11 83753718 unclassified probably benign
R6136:Heatr6 UTSW 11 83772503 missense possibly damaging 0.94
R6145:Heatr6 UTSW 11 83766136 missense probably damaging 1.00
R6649:Heatr6 UTSW 11 83759365 missense probably benign 0.01
R6653:Heatr6 UTSW 11 83759365 missense probably benign 0.01
R6791:Heatr6 UTSW 11 83758341 missense probably benign
R6865:Heatr6 UTSW 11 83769140 missense probably damaging 1.00
R7154:Heatr6 UTSW 11 83777241 missense probably benign 0.05
R7385:Heatr6 UTSW 11 83759335 missense probably damaging 0.96
R7473:Heatr6 UTSW 11 83781391 missense probably damaging 1.00
R7959:Heatr6 UTSW 11 83781363 nonsense probably null
R8034:Heatr6 UTSW 11 83753909 missense probably benign 0.01
R8202:Heatr6 UTSW 11 83759408 missense possibly damaging 0.53
R8398:Heatr6 UTSW 11 83781338 missense probably benign 0.01
X0014:Heatr6 UTSW 11 83781250 missense probably damaging 0.97
Z1177:Heatr6 UTSW 11 83766081 missense probably benign 0.00
Z1177:Heatr6 UTSW 11 83781382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACGGGACATTTAAAAGCATGGG -3'
(R):5'- CCTTTAGCAACAGCACAGACTGGC -3'

Sequencing Primer
(F):5'- CATTTAAAAGCATGGGCTCTGG -3'
(R):5'- GCACAGACTGGCCTACTC -3'
Posted On2013-06-12