Incidental Mutation 'R0537:Tcam1'
ID 49511
Institutional Source Beutler Lab
Gene Symbol Tcam1
Ensembl Gene ENSMUSG00000020712
Gene Name testicular cell adhesion molecule 1
Synonyms 4930570F09Rik
MMRRC Submission 038729-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0537 (G1)
Quality Score 147
Status Validated
Chromosome 11
Chromosomal Location 106167498-106179571 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 106174904 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 120 (E120K)
Ref Sequence ENSEMBL: ENSMUSP00000044757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044462] [ENSMUST00000142472]
AlphaFold Q99NB3
Predicted Effect probably benign
Transcript: ENSMUST00000044462
AA Change: E120K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044757
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 5.4e-30 PFAM
IG_like 117 214 1.66e2 SMART
IG_like 316 397 5.04e1 SMART
IG 408 478 2.79e0 SMART
transmembrane domain 488 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142472
AA Change: E120K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115544
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 3.2e-30 PFAM
Pfam:Ig_2 109 214 1.7e-2 PFAM
Pfam:Ig_2 311 396 5.1e-3 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 35,818,657 (GRCm39) K218N probably benign Het
Acot11 T C 4: 106,619,652 (GRCm39) E156G probably benign Het
Arhgef28 A T 13: 98,094,224 (GRCm39) N973K probably damaging Het
B4galt3 T C 1: 171,101,821 (GRCm39) probably benign Het
Bmpr1a T C 14: 34,165,769 (GRCm39) probably benign Het
Camkmt A T 17: 85,702,087 (GRCm39) I184F probably benign Het
Ccdc33 T C 9: 58,024,737 (GRCm39) Y163C probably damaging Het
Ccdc9 A G 7: 16,014,701 (GRCm39) probably benign Het
Dars2 A T 1: 160,888,318 (GRCm39) C201S possibly damaging Het
Dnajc1 A T 2: 18,312,767 (GRCm39) S194R possibly damaging Het
Dock8 A G 19: 25,148,941 (GRCm39) D1473G probably benign Het
Dpm2 T A 2: 32,462,961 (GRCm39) probably null Het
Dsg4 T C 18: 20,591,628 (GRCm39) S456P probably damaging Het
Gys1 T C 7: 45,089,425 (GRCm39) S195P probably damaging Het
Heatr6 G T 11: 83,670,290 (GRCm39) E948* probably null Het
Itgal G A 7: 126,910,445 (GRCm39) R518Q possibly damaging Het
Klhdc8b G C 9: 108,326,422 (GRCm39) R158G possibly damaging Het
Klhl41 G A 2: 69,500,554 (GRCm39) R5Q probably benign Het
Lrrtm4 A T 6: 79,999,103 (GRCm39) T172S probably benign Het
Lypd1 A G 1: 125,840,604 (GRCm39) probably benign Het
Mei1 T C 15: 81,975,562 (GRCm39) F121S possibly damaging Het
Mtor C T 4: 148,622,817 (GRCm39) R1966W probably damaging Het
Myh7 A G 14: 55,228,256 (GRCm39) F247L possibly damaging Het
Nebl G T 2: 17,409,026 (GRCm39) D392E possibly damaging Het
Notch2 C A 3: 98,024,057 (GRCm39) N840K possibly damaging Het
Nubp1 T C 16: 10,240,678 (GRCm39) probably benign Het
Or5w16 A T 2: 87,577,017 (GRCm39) Q159L probably benign Het
Or7g19 T C 9: 18,856,444 (GRCm39) S167P probably damaging Het
Pcdh17 T A 14: 84,684,897 (GRCm39) S455T probably damaging Het
Picalm C A 7: 89,779,876 (GRCm39) H32Q probably benign Het
Pold1 T C 7: 44,184,516 (GRCm39) E828G probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rala A T 13: 18,063,233 (GRCm39) N119K probably benign Het
Rasal2 A T 1: 156,975,362 (GRCm39) V1149E possibly damaging Het
Rd3 A G 1: 191,715,501 (GRCm39) Y92C probably damaging Het
Rps18-ps6 A T 13: 97,897,071 (GRCm39) F9Y probably benign Het
Sart1 A T 19: 5,431,752 (GRCm39) D635E probably damaging Het
Sec16b A G 1: 157,365,116 (GRCm39) T335A possibly damaging Het
Slc11a2 C T 15: 100,303,679 (GRCm39) G185R probably damaging Het
Slc2a12 G A 10: 22,540,967 (GRCm39) R274H probably damaging Het
Spag17 T C 3: 100,032,618 (GRCm39) V2276A probably damaging Het
Tenm2 T C 11: 36,054,557 (GRCm39) D601G probably damaging Het
Tmem168 C A 6: 13,603,360 (GRCm39) C2F probably damaging Het
Tmem80 A G 7: 140,913,609 (GRCm39) Y13C probably damaging Het
Try4 T A 6: 41,281,296 (GRCm39) N79K probably benign Het
Vldlr C A 19: 27,225,318 (GRCm39) N798K probably damaging Het
Wdr41 A G 13: 95,131,813 (GRCm39) probably benign Het
Zfp30 A T 7: 29,492,160 (GRCm39) E138V probably damaging Het
Zfp366 A C 13: 99,365,786 (GRCm39) T316P probably damaging Het
Zfp563 A T 17: 33,323,659 (GRCm39) S85C possibly damaging Het
Znfx1 T C 2: 166,883,621 (GRCm39) H162R probably damaging Het
Other mutations in Tcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Tcam1 APN 11 106,176,212 (GRCm39) missense probably benign
IGL03396:Tcam1 APN 11 106,176,212 (GRCm39) missense probably benign
IGL03397:Tcam1 APN 11 106,176,212 (GRCm39) missense probably benign
R0241:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0241:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0306:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0313:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0378:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0380:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0381:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0382:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0393:Tcam1 UTSW 11 106,175,040 (GRCm39) missense probably benign 0.19
R0401:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0448:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0602:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R0669:Tcam1 UTSW 11 106,176,252 (GRCm39) missense possibly damaging 0.94
R0706:Tcam1 UTSW 11 106,174,904 (GRCm39) missense probably benign 0.31
R2307:Tcam1 UTSW 11 106,174,940 (GRCm39) missense probably damaging 1.00
R4957:Tcam1 UTSW 11 106,173,705 (GRCm39) missense probably damaging 1.00
R5050:Tcam1 UTSW 11 106,176,278 (GRCm39) missense possibly damaging 0.93
R5269:Tcam1 UTSW 11 106,176,353 (GRCm39) missense probably benign 0.24
R5437:Tcam1 UTSW 11 106,176,249 (GRCm39) missense probably damaging 1.00
R6235:Tcam1 UTSW 11 106,174,880 (GRCm39) nonsense probably null
R6248:Tcam1 UTSW 11 106,173,652 (GRCm39) missense probably benign 0.17
R6302:Tcam1 UTSW 11 106,177,276 (GRCm39) missense probably damaging 1.00
R7399:Tcam1 UTSW 11 106,174,911 (GRCm39) missense probably damaging 1.00
R8236:Tcam1 UTSW 11 106,177,243 (GRCm39) missense probably benign 0.01
R8402:Tcam1 UTSW 11 106,177,731 (GRCm39) missense probably damaging 0.99
R8751:Tcam1 UTSW 11 106,176,443 (GRCm39) missense possibly damaging 0.83
R8801:Tcam1 UTSW 11 106,173,618 (GRCm39) missense probably benign
R9228:Tcam1 UTSW 11 106,177,292 (GRCm39) missense probably damaging 1.00
R9233:Tcam1 UTSW 11 106,175,018 (GRCm39) missense probably benign 0.00
R9621:Tcam1 UTSW 11 106,176,259 (GRCm39) missense probably damaging 1.00
Z1177:Tcam1 UTSW 11 106,173,676 (GRCm39) missense probably benign 0.20
Z1177:Tcam1 UTSW 11 106,173,673 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAAGCTTCTTATGCCTCTGAGACC -3'
(R):5'- AGAAATTACGCCTGTCATTGTCCCG -3'

Sequencing Primer
(F):5'- GCCTCTGAGACCTCTCTGATAAG -3'
(R):5'- CGGTGGGCTCTGACAGTG -3'
Posted On 2013-06-12