Incidental Mutation 'R0537:Tcam1'
ID49511
Institutional Source Beutler Lab
Gene Symbol Tcam1
Ensembl Gene ENSMUSG00000020712
Gene Nametesticular cell adhesion molecule 1
Synonyms
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0537 (G1)
Quality Score147
Status Validated
Chromosome11
Chromosomal Location106276672-106288745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106284078 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 120 (E120K)
Ref Sequence ENSEMBL: ENSMUSP00000044757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044462] [ENSMUST00000142472]
Predicted Effect probably benign
Transcript: ENSMUST00000044462
AA Change: E120K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044757
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 5.4e-30 PFAM
IG_like 117 214 1.66e2 SMART
IG_like 316 397 5.04e1 SMART
IG 408 478 2.79e0 SMART
transmembrane domain 488 510 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142472
AA Change: E120K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115544
Gene: ENSMUSG00000020712
AA Change: E120K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 112 3.2e-30 PFAM
Pfam:Ig_2 109 214 1.7e-2 PFAM
Pfam:Ig_2 311 396 5.1e-3 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Tcam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Tcam1 APN 11 106285386 missense probably benign
IGL03396:Tcam1 APN 11 106285386 missense probably benign
IGL03397:Tcam1 APN 11 106285386 missense probably benign
R0241:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0241:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0306:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0313:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0378:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0380:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0381:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0382:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0393:Tcam1 UTSW 11 106284214 missense probably benign 0.19
R0401:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0448:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0602:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R0669:Tcam1 UTSW 11 106285426 missense possibly damaging 0.94
R0706:Tcam1 UTSW 11 106284078 missense probably benign 0.31
R2307:Tcam1 UTSW 11 106284114 missense probably damaging 1.00
R4957:Tcam1 UTSW 11 106282879 missense probably damaging 1.00
R5050:Tcam1 UTSW 11 106285452 missense possibly damaging 0.93
R5269:Tcam1 UTSW 11 106285527 missense probably benign 0.24
R5437:Tcam1 UTSW 11 106285423 missense probably damaging 1.00
R6235:Tcam1 UTSW 11 106284054 nonsense probably null
R6248:Tcam1 UTSW 11 106282826 missense probably benign 0.17
R6302:Tcam1 UTSW 11 106286450 missense probably damaging 1.00
R7399:Tcam1 UTSW 11 106284085 missense probably damaging 1.00
R8236:Tcam1 UTSW 11 106286417 missense probably benign 0.01
Z1177:Tcam1 UTSW 11 106282847 frame shift probably null
Z1177:Tcam1 UTSW 11 106282850 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- CCAAGCTTCTTATGCCTCTGAGACC -3'
(R):5'- AGAAATTACGCCTGTCATTGTCCCG -3'

Sequencing Primer
(F):5'- GCCTCTGAGACCTCTCTGATAAG -3'
(R):5'- CGGTGGGCTCTGACAGTG -3'
Posted On2013-06-12