Incidental Mutation 'R0537:Bmpr1a'
ID49516
Institutional Source Beutler Lab
Gene Symbol Bmpr1a
Ensembl Gene ENSMUSG00000021796
Gene Namebone morphogenetic protein receptor, type 1A
SynonymsBMPR-IA, 1110037I22Rik, Bmpr, ALK3
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34410734-34503341 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 34443812 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049005] [ENSMUST00000165280] [ENSMUST00000171343] [ENSMUST00000171551]
Predicted Effect probably benign
Transcript: ENSMUST00000049005
SMART Domains Protein: ENSMUSP00000035900
Gene: ENSMUSG00000021796

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 4.6e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165280
SMART Domains Protein: ENSMUSP00000131984
Gene: ENSMUSG00000021796

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 1.3e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171343
SMART Domains Protein: ENSMUSP00000126852
Gene: ENSMUSG00000021796

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171551
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The bone morphogenetic protein (BMP) receptors are a family of transmembrane serine/threonine kinases that include the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. These receptors are also closely related to the activin receptors, ACVR1 and ACVR2. The ligands of these receptors are members of the TGF-beta superfamily. TGF-betas and activins transduce their signals through the formation of heteromeric complexes with 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 9.5, are smaller than normal, and form no mesoderm; a conditional knockout resulted in gross malformations of the limbs with complete agenesis of the hindlimb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Bmpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Bmpr1a APN 14 34434419 missense probably benign
IGL03100:Bmpr1a APN 14 34441207 unclassified probably benign
R0329:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0330:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0411:Bmpr1a UTSW 14 34415877 missense possibly damaging 0.58
R1707:Bmpr1a UTSW 14 34425141 splice site probably benign
R1767:Bmpr1a UTSW 14 34447770 critical splice donor site probably null
R1992:Bmpr1a UTSW 14 34425093 missense probably damaging 1.00
R3757:Bmpr1a UTSW 14 34434667 nonsense probably null
R4125:Bmpr1a UTSW 14 34434733 missense probably benign 0.35
R5320:Bmpr1a UTSW 14 34425042 missense probably damaging 1.00
R6956:Bmpr1a UTSW 14 34441175 missense possibly damaging 0.90
R7254:Bmpr1a UTSW 14 34414763 missense probably benign 0.03
R7267:Bmpr1a UTSW 14 34443879 missense possibly damaging 0.47
R7270:Bmpr1a UTSW 14 34441125 missense probably damaging 0.96
R8166:Bmpr1a UTSW 14 34425069 missense probably damaging 1.00
R8348:Bmpr1a UTSW 14 34414802 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- GTATCTACCCTCTGCTCTAACTGGCTAA -3'
(R):5'- CATCCTCAAAAGTTCTCCGGTGCTTA -3'

Sequencing Primer
(F):5'- tgcatacctttaatcctagcactc -3'
(R):5'- AGCCCTTAGCCTTTAGGGAGAG -3'
Posted On2013-06-12