Incidental Mutation 'R0537:Mei1'
ID49520
Institutional Source Beutler Lab
Gene Symbol Mei1
Ensembl Gene ENSMUSG00000068117
Gene Namemeiotic double-stranded break formation protein 1
Synonymsmei1
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82069996-82126814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82091361 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 121 (F121S)
Ref Sequence ENSEMBL: ENSMUSP00000140479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089178] [ENSMUST00000186125] [ENSMUST00000188048] [ENSMUST00000189540] [ENSMUST00000229119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089178
AA Change: F495S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086582
Gene: ENSMUSG00000068117
AA Change: F495S

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
SCOP:d1gw5a_ 123 498 1e-3 SMART
low complexity region 956 966 N/A INTRINSIC
low complexity region 1025 1045 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186125
AA Change: F121S

PolyPhen 2 Score 0.731 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000188048
AA Change: F121S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139689
Gene: ENSMUSG00000068117
AA Change: F121S

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189540
AA Change: F121S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140479
Gene: ENSMUSG00000068117
AA Change: F121S

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000229119
AA Change: F545S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.1582 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygous mutant mice of both sexes exhibit meiotic defects and are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Mei1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Mei1 APN 15 82089552 missense probably damaging 0.99
IGL01776:Mei1 APN 15 82095932 critical splice donor site probably null
IGL01864:Mei1 APN 15 82113017 splice site probably benign
IGL02030:Mei1 APN 15 82115743 missense probably benign
IGL02148:Mei1 APN 15 82092711 nonsense probably null
R0135:Mei1 UTSW 15 82071969 nonsense probably null
R0212:Mei1 UTSW 15 82095931 critical splice donor site probably null
R0605:Mei1 UTSW 15 82070150 missense probably benign
R0727:Mei1 UTSW 15 82070149 missense probably benign 0.01
R1118:Mei1 UTSW 15 82115867 splice site probably benign
R1226:Mei1 UTSW 15 82080084 missense possibly damaging 0.92
R1339:Mei1 UTSW 15 82081995 missense possibly damaging 0.66
R1558:Mei1 UTSW 15 82107133 missense probably damaging 1.00
R1769:Mei1 UTSW 15 82112570 intron probably null
R1868:Mei1 UTSW 15 82124953 missense probably damaging 1.00
R1980:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1981:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1982:Mei1 UTSW 15 82103312 missense probably benign 0.00
R2103:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R2103:Mei1 UTSW 15 82107036 missense probably damaging 0.99
R2207:Mei1 UTSW 15 82103249 missense probably benign 0.08
R2444:Mei1 UTSW 15 82112941 missense probably damaging 1.00
R3009:Mei1 UTSW 15 82112525 missense probably damaging 0.97
R3114:Mei1 UTSW 15 82124959 missense probably benign 0.31
R3546:Mei1 UTSW 15 82098042 missense probably damaging 0.97
R3720:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3721:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3722:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3752:Mei1 UTSW 15 82086182 missense probably damaging 0.97
R3778:Mei1 UTSW 15 82082008 missense probably damaging 1.00
R3848:Mei1 UTSW 15 82113017 splice site probably benign
R3933:Mei1 UTSW 15 82083152 missense possibly damaging 0.75
R4274:Mei1 UTSW 15 82124863 missense possibly damaging 0.66
R4765:Mei1 UTSW 15 82112485 missense possibly damaging 0.96
R5070:Mei1 UTSW 15 82077603 missense possibly damaging 0.66
R5394:Mei1 UTSW 15 82092756 missense possibly damaging 0.83
R6108:Mei1 UTSW 15 82075188 missense possibly damaging 0.66
R6302:Mei1 UTSW 15 82103238 nonsense probably null
R6849:Mei1 UTSW 15 82079945 missense possibly damaging 0.92
R6913:Mei1 UTSW 15 82089609 missense probably benign 0.06
R6919:Mei1 UTSW 15 82081930 missense probably damaging 0.98
R6959:Mei1 UTSW 15 82124875 missense probably benign 0.01
R7007:Mei1 UTSW 15 82093999 missense probably damaging 0.99
R7202:Mei1 UTSW 15 82092642 missense
R7374:Mei1 UTSW 15 82095908 missense
R7438:Mei1 UTSW 15 82115481 missense
R7757:Mei1 UTSW 15 82082623 intron probably benign
R7857:Mei1 UTSW 15 82092717 missense not run
R7940:Mei1 UTSW 15 82092717 missense not run
RF051:Mei1 UTSW 15 82070010 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGATAGACCAAGAGCCCTTCCTGAG -3'
(R):5'- GTCCCTTCACAATTCTGGAGAGCAAC -3'

Sequencing Primer
(F):5'- ACGCTCCCTTGGAAAGTCAG -3'
(R):5'- CAGAAGCCAAGTGTTCGTG -3'
Posted On2013-06-12