Incidental Mutation 'R0537:Slc11a2'
ID49521
Institutional Source Beutler Lab
Gene Symbol Slc11a2
Ensembl Gene ENSMUSG00000023030
Gene Namesolute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
SynonymsDMT1, van, DCT1, Nramp2, microcytic anemia, viable anaemia
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R0537 (G1)
Quality Score208
Status Validated
Chromosome15
Chromosomal Location100387898-100425072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100405798 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 185 (G185R)
Ref Sequence ENSEMBL: ENSMUSP00000116463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023774] [ENSMUST00000123461] [ENSMUST00000124324] [ENSMUST00000136168] [ENSMUST00000138843] [ENSMUST00000154331] [ENSMUST00000154676]
Predicted Effect probably damaging
Transcript: ENSMUST00000023774
AA Change: G185R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023774
Gene: ENSMUSG00000023030
AA Change: G185R

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Nramp 90 474 1.1e-122 PFAM
transmembrane domain 505 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123461
SMART Domains Protein: ENSMUSP00000119056
Gene: ENSMUSG00000023030

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Nramp 90 170 2.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124324
SMART Domains Protein: ENSMUSP00000114702
Gene: ENSMUSG00000023030

DomainStartEndE-ValueType
Pfam:Nramp 1 165 1.4e-39 PFAM
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136168
Predicted Effect probably damaging
Transcript: ENSMUST00000138843
AA Change: G185R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116463
Gene: ENSMUSG00000023030
AA Change: G185R

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Pfam:Nramp 90 474 4.7e-118 PFAM
transmembrane domain 505 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140535
Predicted Effect probably benign
Transcript: ENSMUST00000154331
SMART Domains Protein: ENSMUSP00000115357
Gene: ENSMUSG00000023030

DomainStartEndE-ValueType
low complexity region 41 56 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154676
SMART Domains Protein: ENSMUSP00000115019
Gene: ENSMUSG00000023030

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 11 protein family. The product of this gene transports divalent metals and is involved in iron absorption. Mutations in this gene are associated with hypochromic microcytic anemia with iron overload. A related solute carrier family 11 protein gene is located on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit microcytic, hypochromic anemia associated with impaired intestinal iron absorption and erythroblast iron uptake. Mutants have reduced viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Slc11a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Slc11a2 APN 15 100397737 missense probably benign
IGL00923:Slc11a2 APN 15 100397788 missense probably benign 0.13
IGL01645:Slc11a2 APN 15 100389118 missense probably benign 0.05
IGL02146:Slc11a2 APN 15 100401288 missense probably damaging 1.00
IGL02397:Slc11a2 APN 15 100401649 missense probably damaging 1.00
IGL02534:Slc11a2 APN 15 100401326 missense probably benign 0.03
IGL02678:Slc11a2 APN 15 100412200 missense possibly damaging 0.71
R0538:Slc11a2 UTSW 15 100408216 missense probably damaging 1.00
R1305:Slc11a2 UTSW 15 100410082 critical splice donor site probably null
R1750:Slc11a2 UTSW 15 100401287 missense probably damaging 1.00
R1752:Slc11a2 UTSW 15 100405806 missense probably damaging 1.00
R1895:Slc11a2 UTSW 15 100403894 missense probably benign 0.10
R2278:Slc11a2 UTSW 15 100410081 critical splice donor site probably null
R2519:Slc11a2 UTSW 15 100401323 missense probably damaging 1.00
R4724:Slc11a2 UTSW 15 100406338 missense possibly damaging 0.65
R5643:Slc11a2 UTSW 15 100403187 missense probably benign
R5667:Slc11a2 UTSW 15 100403288 missense probably damaging 1.00
R5671:Slc11a2 UTSW 15 100403288 missense probably damaging 1.00
R5994:Slc11a2 UTSW 15 100397681 missense probably benign
R7008:Slc11a2 UTSW 15 100409324 missense probably damaging 1.00
R7208:Slc11a2 UTSW 15 100402332 missense probably benign 0.00
R7547:Slc11a2 UTSW 15 100397770 missense possibly damaging 0.83
R7829:Slc11a2 UTSW 15 100409261 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCAGCACTTGCCTCATATCCAAAC -3'
(R):5'- GCAAGGCTGCTTATTCCACTGCAC -3'

Sequencing Primer
(F):5'- TCATATCCAAACGTGAGGGC -3'
(R):5'- agctgtgtcccacacatc -3'
Posted On2013-06-12