Incidental Mutation 'R0537:Sart1'
ID49526
Institutional Source Beutler Lab
Gene Symbol Sart1
Ensembl Gene ENSMUSG00000039148
Gene Namesquamous cell carcinoma antigen recognized by T cells 1
SynonymsU5-110K
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0537 (G1)
Quality Score143
Status Validated
Chromosome19
Chromosomal Location5377523-5388703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5381724 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 635 (D635E)
Ref Sequence ENSEMBL: ENSMUSP00000047397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044207]
Predicted Effect probably damaging
Transcript: ENSMUST00000044207
AA Change: D635E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047397
Gene: ENSMUSG00000039148
AA Change: D635E

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 31 83 N/A INTRINSIC
Pfam:SART-1 117 759 1.5e-151 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins, the SART1(800) protein expressed in the nucleus of the majority of proliferating cells, and the SART1(259) protein expressed in the cytosol of epithelial cancers. The SART1(259) protein is translated by the mechanism of -1 frameshifting during posttranscriptional regulation; its full-length sequence is not published yet. The two encoded proteins are thought to be involved in the regulation of proliferation. Both proteins have tumor-rejection antigens. The SART1(259) protein possesses tumor epitopes capable of inducing HLA-A2402-restricted cytotoxic T lymphocytes in cancer patients. This SART1(259) antigen may be useful in specific immunotherapy for cancer patients and may serve as a paradigmatic tool for the diagnosis and treatment of patients with atopy. The SART1(259) protein is found to be essential for the recruitment of the tri-snRNP to the pre-spliceosome in the spliceosome assembly pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Vldlr C A 19: 27,247,918 N798K probably damaging Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Sart1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Sart1 APN 19 5383951 missense probably benign 0.00
IGL02390:Sart1 APN 19 5380461 missense possibly damaging 0.85
IGL02533:Sart1 APN 19 5383721 nonsense probably null
IGL03094:Sart1 APN 19 5384081 splice site probably benign
R0219:Sart1 UTSW 19 5388396 missense probably benign
R0226:Sart1 UTSW 19 5381122 splice site probably benign
R0304:Sart1 UTSW 19 5380531 splice site probably benign
R0668:Sart1 UTSW 19 5384256 missense probably damaging 1.00
R1574:Sart1 UTSW 19 5380259 missense probably damaging 1.00
R1574:Sart1 UTSW 19 5380259 missense probably damaging 1.00
R1674:Sart1 UTSW 19 5385825 missense probably damaging 0.99
R4077:Sart1 UTSW 19 5382743 missense possibly damaging 0.48
R4866:Sart1 UTSW 19 5382220 missense probably damaging 1.00
R5081:Sart1 UTSW 19 5388548 missense possibly damaging 0.72
R5523:Sart1 UTSW 19 5383676 missense probably damaging 0.99
R5756:Sart1 UTSW 19 5380469 missense probably damaging 1.00
R5875:Sart1 UTSW 19 5383795 missense probably damaging 1.00
R5979:Sart1 UTSW 19 5381223 missense probably damaging 1.00
R7360:Sart1 UTSW 19 5383203 missense probably damaging 0.96
R7560:Sart1 UTSW 19 5384877 missense probably damaging 0.97
R7764:Sart1 UTSW 19 5388585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCCGCATCTTTACGGACATC -3'
(R):5'- AGTTGTCCAGTGCCTGAAAGCC -3'

Sequencing Primer
(F):5'- GCCCCAGTGTATCCGGTTTAG -3'
(R):5'- GTGCCTGAAAGCCTCCAC -3'
Posted On2013-06-12