Incidental Mutation 'R0537:Vldlr'
ID49528
Institutional Source Beutler Lab
Gene Symbol Vldlr
Ensembl Gene ENSMUSG00000024924
Gene Namevery low density lipoprotein receptor
SynonymsAA408956, AI451093, AW047288, VLDL receptor
MMRRC Submission 038729-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R0537 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location27216484-27254231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27247918 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 798 (N798K)
Ref Sequence ENSEMBL: ENSMUSP00000126730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]
Predicted Effect probably benign
Transcript: ENSMUST00000025866
SMART Domains Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
Blast:LY 461 495 4e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000047645
AA Change: N757K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: N757K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 1.25e-14 SMART
LDLa 112 149 7.15e-15 SMART
LDLa 151 190 1.23e-13 SMART
LDLa 197 234 1.1e-15 SMART
LDLa 236 273 1.13e-12 SMART
LDLa 276 316 3.86e-11 SMART
EGF_CA 315 354 1e-5 SMART
EGF_CA 355 394 6.1e-10 SMART
LY 420 462 2.16e-1 SMART
LY 464 506 9.54e-12 SMART
LY 507 550 2.22e-12 SMART
LY 551 593 1.66e-11 SMART
LY 594 637 5.97e-4 SMART
EGF 664 709 2.16e-1 SMART
transmembrane domain 728 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164509
Predicted Effect probably benign
Transcript: ENSMUST00000165761
SMART Domains Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924

DomainStartEndE-ValueType
LDLa 1 26 1.58e0 SMART
EGF 28 64 4e-5 SMART
LY 88 130 2.16e-1 SMART
LY 132 174 9.54e-12 SMART
LY 175 218 2.22e-12 SMART
LY 219 258 3.25e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167487
AA Change: N826K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: N826K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 797 819 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172302
AA Change: N798K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: N798K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
EGF_like 32 68 7.38e1 SMART
LDLa 32 69 1.69e-16 SMART
LDLa 71 110 5.81e-15 SMART
LDLa 112 151 1.96e-12 SMART
LDLa 153 190 7.15e-15 SMART
LDLa 192 231 1.23e-13 SMART
LDLa 238 275 1.1e-15 SMART
LDLa 277 314 1.13e-12 SMART
LDLa 317 357 3.86e-11 SMART
EGF_CA 356 395 1e-5 SMART
EGF_CA 396 435 6.1e-10 SMART
LY 461 503 2.16e-1 SMART
LY 505 547 9.54e-12 SMART
LY 548 591 2.22e-12 SMART
LY 592 634 1.66e-11 SMART
LY 635 678 5.97e-4 SMART
EGF 705 750 2.16e-1 SMART
transmembrane domain 769 791 N/A INTRINSIC
Meta Mutation Damage Score 0.4567 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A T 14: 36,096,700 K218N probably benign Het
Acot11 T C 4: 106,762,455 E156G probably benign Het
Arhgef28 A T 13: 97,957,716 N973K probably damaging Het
B4galt3 T C 1: 171,274,251 probably benign Het
Bmpr1a T C 14: 34,443,812 probably benign Het
Camkmt A T 17: 85,394,659 I184F probably benign Het
Ccdc33 T C 9: 58,117,454 Y163C probably damaging Het
Ccdc9 A G 7: 16,280,776 probably benign Het
Dars2 A T 1: 161,060,748 C201S possibly damaging Het
Dnajc1 A T 2: 18,307,956 S194R possibly damaging Het
Dock8 A G 19: 25,171,577 D1473G probably benign Het
Dpm2 T A 2: 32,572,949 probably null Het
Dsg4 T C 18: 20,458,571 S456P probably damaging Het
Gm10260 A T 13: 97,760,563 F9Y probably benign Het
Gys1 T C 7: 45,440,001 S195P probably damaging Het
Heatr6 G T 11: 83,779,464 E948* probably null Het
Itgal G A 7: 127,311,273 R518Q possibly damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lrrtm4 A T 6: 80,022,120 T172S probably benign Het
Lypd1 A G 1: 125,912,867 probably benign Het
Mei1 T C 15: 82,091,361 F121S possibly damaging Het
Mtor C T 4: 148,538,360 R1966W probably damaging Het
Myh7 A G 14: 54,990,799 F247L possibly damaging Het
Nebl G T 2: 17,404,215 D392E possibly damaging Het
Notch2 C A 3: 98,116,741 N840K possibly damaging Het
Nubp1 T C 16: 10,422,814 probably benign Het
Olfr1140 A T 2: 87,746,673 Q159L probably benign Het
Olfr832 T C 9: 18,945,148 S167P probably damaging Het
Pcdh17 T A 14: 84,447,457 S455T probably damaging Het
Picalm C A 7: 90,130,668 H32Q probably benign Het
Pold1 T C 7: 44,535,092 E828G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rala A T 13: 17,888,648 N119K probably benign Het
Rasal2 A T 1: 157,147,792 V1149E possibly damaging Het
Rd3 A G 1: 191,983,540 Y92C probably damaging Het
Sart1 A T 19: 5,381,724 D635E probably damaging Het
Sec16b A G 1: 157,537,546 T335A possibly damaging Het
Slc11a2 C T 15: 100,405,798 G185R probably damaging Het
Slc2a12 G A 10: 22,665,068 R274H probably damaging Het
Spag17 T C 3: 100,125,302 V2276A probably damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Tmem168 C A 6: 13,603,361 C2F probably damaging Het
Tmem80 A G 7: 141,333,696 Y13C probably damaging Het
Try4 T A 6: 41,304,362 N79K probably benign Het
Wdr41 A G 13: 94,995,305 probably benign Het
Zfp30 A T 7: 29,792,735 E138V probably damaging Het
Zfp366 A C 13: 99,229,278 T316P probably damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Znfx1 T C 2: 167,041,701 H162R probably damaging Het
Other mutations in Vldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vldlr APN 19 27239681 missense possibly damaging 0.93
IGL01575:Vldlr APN 19 27246631 missense probably benign
IGL01626:Vldlr APN 19 27243773 missense probably damaging 1.00
IGL02213:Vldlr APN 19 27241326 missense probably benign 0.09
IGL02365:Vldlr APN 19 27245625 missense probably damaging 1.00
IGL02488:Vldlr APN 19 27238275 missense probably damaging 1.00
IGL02708:Vldlr APN 19 27238085 missense possibly damaging 0.92
IGL02947:Vldlr APN 19 27239720 missense probably benign 0.03
r26 UTSW 19 27245654 missense probably damaging 0.99
spotty UTSW 19 27238792 missense probably damaging 1.00
PIT4142001:Vldlr UTSW 19 27234869 missense probably benign 0.05
R0195:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R0288:Vldlr UTSW 19 27240651 splice site probably benign
R0536:Vldlr UTSW 19 27239964 missense probably damaging 1.00
R0542:Vldlr UTSW 19 27236255 missense probably benign 0.01
R0594:Vldlr UTSW 19 27234819 missense probably damaging 1.00
R0624:Vldlr UTSW 19 27238263 missense possibly damaging 0.91
R0726:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R1017:Vldlr UTSW 19 27241333 missense probably damaging 1.00
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1148:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1443:Vldlr UTSW 19 27239721 missense possibly damaging 0.91
R1493:Vldlr UTSW 19 27241291 missense probably benign 0.01
R1520:Vldlr UTSW 19 27240543 missense probably damaging 0.99
R1520:Vldlr UTSW 19 27247066 missense possibly damaging 0.96
R1657:Vldlr UTSW 19 27245670 missense probably benign 0.00
R1901:Vldlr UTSW 19 27241309 missense probably damaging 1.00
R2047:Vldlr UTSW 19 27234838 missense probably damaging 1.00
R2258:Vldlr UTSW 19 27238386 missense probably damaging 1.00
R2273:Vldlr UTSW 19 27248015 missense probably damaging 1.00
R2423:Vldlr UTSW 19 27236288 missense possibly damaging 0.49
R3196:Vldlr UTSW 19 27243154 missense probably damaging 0.98
R3752:Vldlr UTSW 19 27238331 missense probably damaging 1.00
R3801:Vldlr UTSW 19 27217621 missense probably damaging 0.99
R3835:Vldlr UTSW 19 27234814 missense probably damaging 1.00
R4027:Vldlr UTSW 19 27238313 missense probably benign
R4301:Vldlr UTSW 19 27238402 missense possibly damaging 0.80
R4470:Vldlr UTSW 19 27234819 missense probably damaging 0.96
R4541:Vldlr UTSW 19 27238792 missense probably damaging 1.00
R4765:Vldlr UTSW 19 27240547 missense probably damaging 1.00
R4771:Vldlr UTSW 19 27239890 missense probably damaging 0.97
R4795:Vldlr UTSW 19 27238852 splice site probably null
R4839:Vldlr UTSW 19 27238065 missense probably damaging 1.00
R5074:Vldlr UTSW 19 27238277 missense probably damaging 1.00
R5134:Vldlr UTSW 19 27238812 nonsense probably null
R5281:Vldlr UTSW 19 27244231 missense probably benign 0.44
R5466:Vldlr UTSW 19 27239843 critical splice acceptor site probably null
R5514:Vldlr UTSW 19 27244224 missense probably damaging 0.97
R5886:Vldlr UTSW 19 27243771 missense probably benign 0.03
R5889:Vldlr UTSW 19 27239664 missense probably damaging 1.00
R6110:Vldlr UTSW 19 27238077 missense possibly damaging 0.92
R6343:Vldlr UTSW 19 27245649 missense probably damaging 0.99
R6833:Vldlr UTSW 19 27240574 missense probably damaging 1.00
R6838:Vldlr UTSW 19 27247970 missense probably damaging 1.00
R7169:Vldlr UTSW 19 27244328 missense probably benign
R7197:Vldlr UTSW 19 27234841 missense probably benign 0.36
R7304:Vldlr UTSW 19 27238604 missense possibly damaging 0.93
R7403:Vldlr UTSW 19 27236274 nonsense probably null
R7658:Vldlr UTSW 19 27243136 missense probably benign 0.33
R7754:Vldlr UTSW 19 27217615 start codon destroyed probably benign 0.01
R8105:Vldlr UTSW 19 27238804 nonsense probably null
R8377:Vldlr UTSW 19 27234858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTCACACAACCACTGGGCTG -3'
(R):5'- TCCCCTTCCTCTGTGGGTGAAATG -3'

Sequencing Primer
(F):5'- CAACCACTGGGCTGAATTTATTTC -3'
(R):5'- CCAGGTAGCCATAGCTAGTGATTC -3'
Posted On2013-06-12