Incidental Mutation 'R0538:Kif1a'
ID 49535
Institutional Source Beutler Lab
Gene Symbol Kif1a
Ensembl Gene ENSMUSG00000014602
Gene Name kinesin family member 1A
Synonyms N-3 kinesin, C630002N23Rik, Kns1, LOC381283, ATSV
MMRRC Submission 038730-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.846) question?
Stock # R0538 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 92943186-93029673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 92971360 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1006 (R1006L)
Ref Sequence ENSEMBL: ENSMUSP00000140163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086819] [ENSMUST00000112958] [ENSMUST00000171556] [ENSMUST00000171796] [ENSMUST00000190723]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000086819
AA Change: R913L

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084029
Gene: ENSMUSG00000014602
AA Change: R913L

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 411 429 N/A INTRINSIC
FHA 524 581 1.39e-8 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 6.4e-13 PFAM
Pfam:DUF3694 1157 1305 1.8e-47 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112958
AA Change: R904L

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108582
Gene: ENSMUSG00000014602
AA Change: R904L

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 851 3.9e-15 PFAM
Pfam:DUF3694 1148 1304 5e-40 PFAM
low complexity region 1420 1444 N/A INTRINSIC
low complexity region 1541 1549 N/A INTRINSIC
PH 1584 1683 1.52e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171556
AA Change: R904L

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130717
Gene: ENSMUSG00000014602
AA Change: R904L

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 2.7e-13 PFAM
Pfam:DUF3694 1148 1296 8.4e-48 PFAM
low complexity region 1411 1435 N/A INTRINSIC
low complexity region 1532 1540 N/A INTRINSIC
PH 1575 1674 1.52e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171796
AA Change: R904L

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128432
Gene: ENSMUSG00000014602
AA Change: R904L

DomainStartEndE-ValueType
KISc 3 362 1.05e-177 SMART
low complexity region 402 420 N/A INTRINSIC
FHA 515 572 1.39e-8 SMART
coiled coil region 625 679 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
Pfam:KIF1B 805 852 6.4e-13 PFAM
Pfam:DUF3694 1148 1304 1.8e-46 PFAM
low complexity region 1419 1443 N/A INTRINSIC
low complexity region 1540 1548 N/A INTRINSIC
PH 1583 1682 1.52e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188493
Predicted Effect probably damaging
Transcript: ENSMUST00000190723
AA Change: R1006L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140163
Gene: ENSMUSG00000014602
AA Change: R1006L

DomainStartEndE-ValueType
KISc 3 362 5.2e-180 SMART
low complexity region 411 429 N/A INTRINSIC
coiled coil region 438 471 N/A INTRINSIC
FHA 524 581 6.9e-11 SMART
coiled coil region 634 688 N/A INTRINSIC
low complexity region 693 706 N/A INTRINSIC
low complexity region 762 778 N/A INTRINSIC
Pfam:KIF1B 814 861 4e-10 PFAM
low complexity region 885 900 N/A INTRINSIC
coiled coil region 901 929 N/A INTRINSIC
internal_repeat_1 938 957 5.9e-5 PROSPERO
Pfam:DUF3694 1250 1398 1.1e-44 PFAM
low complexity region 1513 1537 N/A INTRINSIC
low complexity region 1634 1642 N/A INTRINSIC
PH 1677 1776 6.9e-16 SMART
Meta Mutation Damage Score 0.1634 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the kinesin family and functions as an anterograde motor protein that transports membranous organelles along axonal microtubules. Mutations at this locus have been associated with spastic paraplegia-30 and hereditary sensory neuropathy IIC. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Most mice homozygous for a null allele die within a day of birth, with reduced motor and sensory deficits, decreased synaptic vesicle precursor transport, and significant neuronal degeneration in the central nervous system, but two point mutant alleles cause progressive hindleg paralysis [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 67,175,823 (GRCm39) H6L unknown Het
Abca13 G A 11: 9,217,622 (GRCm39) probably null Het
Acad12 C T 5: 121,745,511 (GRCm39) R260Q possibly damaging Het
Actn1 G A 12: 80,306,874 (GRCm39) probably benign Het
Acvrl1 A G 15: 101,034,030 (GRCm39) T182A probably damaging Het
Adam23 T C 1: 63,607,003 (GRCm39) probably benign Het
Adamtsl1 A T 4: 86,261,358 (GRCm39) T1190S probably benign Het
Adh6b A T 3: 138,063,411 (GRCm39) Y330F probably benign Het
Ak7 A G 12: 105,732,876 (GRCm39) E540G probably damaging Het
Akr1c19 T A 13: 4,287,099 (GRCm39) L106Q probably damaging Het
Ankrd12 A T 17: 66,356,847 (GRCm39) S57T probably damaging Het
Aoc3 G A 11: 101,222,964 (GRCm39) R400Q possibly damaging Het
Arel1 A T 12: 84,988,611 (GRCm39) I46N probably damaging Het
Armc5 A G 7: 127,843,463 (GRCm39) D752G probably damaging Het
Atp11b T C 3: 35,891,163 (GRCm39) V812A probably damaging Het
Axin1 A G 17: 26,403,215 (GRCm39) H131R possibly damaging Het
Bpifb3 A G 2: 153,765,789 (GRCm39) E184G probably benign Het
Cacna2d2 T C 9: 107,401,582 (GRCm39) probably benign Het
Catsperd T C 17: 56,969,828 (GRCm39) F641L probably benign Het
Ccdc83 A C 7: 89,877,591 (GRCm39) L284V probably damaging Het
Ccn2 T A 10: 24,472,364 (GRCm39) C136S probably damaging Het
Ccnt2 T A 1: 127,730,902 (GRCm39) V593E probably damaging Het
Cd53 T A 3: 106,669,444 (GRCm39) I185F probably benign Het
Cep350 A T 1: 155,724,366 (GRCm39) D3077E possibly damaging Het
Ces1h C A 8: 94,083,628 (GRCm39) probably null Het
Chrna3 T A 9: 54,923,290 (GRCm39) T173S probably benign Het
Clca4b T C 3: 144,627,717 (GRCm39) D418G probably benign Het
Col11a2 T C 17: 34,270,302 (GRCm39) probably benign Het
Coq2 T A 5: 100,815,889 (GRCm39) I97F possibly damaging Het
Cr2 A G 1: 194,842,667 (GRCm39) probably benign Het
D2hgdh A G 1: 93,754,099 (GRCm39) Y24C probably damaging Het
D630045J12Rik G A 6: 38,168,628 (GRCm39) R974C probably damaging Het
Dach1 A G 14: 98,140,715 (GRCm39) V429A possibly damaging Het
Ddr1 G A 17: 35,995,899 (GRCm39) T660I probably damaging Het
Dlg1 A C 16: 31,615,682 (GRCm39) probably null Het
Dmbt1 T C 7: 130,651,631 (GRCm39) probably benign Het
Dmxl2 A T 9: 54,301,120 (GRCm39) D2330E probably benign Het
Dnai4 T C 4: 102,953,815 (GRCm39) N128S possibly damaging Het
Doc2a A G 7: 126,447,983 (GRCm39) T5A probably benign Het
Dock2 G A 11: 34,595,545 (GRCm39) probably benign Het
Dok4 T A 8: 95,591,866 (GRCm39) Y290F probably damaging Het
Dop1a A G 9: 86,367,550 (GRCm39) D11G probably damaging Het
E230025N22Rik T C 18: 36,821,987 (GRCm39) H235R probably benign Het
Ear6 A G 14: 52,091,909 (GRCm39) D152G probably damaging Het
Ecscr T A 18: 35,846,689 (GRCm39) probably benign Het
Eml6 A T 11: 29,710,010 (GRCm39) probably benign Het
Epha4 T A 1: 77,365,178 (GRCm39) Q607L probably damaging Het
Exoc4 A G 6: 33,948,998 (GRCm39) N947S probably benign Het
Flg A G 3: 93,186,767 (GRCm39) E73G probably damaging Het
Fndc1 C T 17: 8,003,173 (GRCm39) probably benign Het
Gad1-ps T C 10: 99,280,854 (GRCm39) noncoding transcript Het
Gata6 A G 18: 11,064,771 (GRCm39) T528A probably benign Het
Gjd4 T C 18: 9,280,244 (GRCm39) E278G probably benign Het
Gm20091 T A 10: 96,244,864 (GRCm39) noncoding transcript Het
Gnb3 G A 6: 124,812,659 (GRCm39) Q266* probably null Het
Grm3 A G 5: 9,562,446 (GRCm39) V468A possibly damaging Het
Igf1r C T 7: 67,857,574 (GRCm39) R1085C probably damaging Het
Igsf10 T C 3: 59,227,527 (GRCm39) T2049A probably damaging Het
Jak3 A T 8: 72,138,126 (GRCm39) D859V probably benign Het
Kcnb2 G T 1: 15,783,108 (GRCm39) probably benign Het
Kcnh3 G A 15: 99,138,839 (GRCm39) G858D probably benign Het
Klhl23 C T 2: 69,654,757 (GRCm39) A209V probably benign Het
Mapk13 T C 17: 28,994,229 (GRCm39) Y104H probably damaging Het
Mbd4 A G 6: 115,826,443 (GRCm39) S183P probably damaging Het
Mga T C 2: 119,750,187 (GRCm39) probably null Het
Mipol1 G A 12: 57,461,197 (GRCm39) probably null Het
Mmp14 A G 14: 54,676,166 (GRCm39) T299A possibly damaging Het
Mmrn1 A G 6: 60,953,453 (GRCm39) E578G probably benign Het
Mov10l1 G A 15: 88,879,063 (GRCm39) C193Y possibly damaging Het
Mppe1 A G 18: 67,370,548 (GRCm39) C50R probably damaging Het
Msantd1 C A 5: 35,075,069 (GRCm39) R44S probably damaging Het
Myt1l T C 12: 29,892,570 (GRCm39) V69A possibly damaging Het
Nav1 A T 1: 135,392,430 (GRCm39) probably benign Het
Ncan A G 8: 70,561,252 (GRCm39) S572P possibly damaging Het
Nck2 T C 1: 43,608,304 (GRCm39) probably benign Het
Nemf A T 12: 69,403,088 (GRCm39) D31E probably damaging Het
Nlrp12 T C 7: 3,297,892 (GRCm39) D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 (GRCm39) probably null Het
Nup98 T C 7: 101,835,892 (GRCm39) T184A probably damaging Het
Oog2 C A 4: 143,922,654 (GRCm39) Y306* probably null Het
Or13a18 A T 7: 140,190,297 (GRCm39) N73Y probably damaging Het
Or6ae1 A T 7: 139,742,144 (GRCm39) S240T probably damaging Het
Or6b2b A T 1: 92,419,055 (GRCm39) C141S possibly damaging Het
Osmr A G 15: 6,871,419 (GRCm39) probably benign Het
P2rx6 A G 16: 17,386,162 (GRCm39) N275S probably benign Het
Pbxip1 G T 3: 89,354,926 (GRCm39) G482W possibly damaging Het
Pcsk4 T G 10: 80,161,168 (GRCm39) I249L probably damaging Het
Pou4f2 C T 8: 79,162,291 (GRCm39) G104E probably damaging Het
Pramel28 T A 4: 143,691,653 (GRCm39) T357S possibly damaging Het
Prkdc G T 16: 15,651,652 (GRCm39) R3763L probably damaging Het
Ptpre A T 7: 135,265,044 (GRCm39) I207F probably damaging Het
Rapgef3 A T 15: 97,655,698 (GRCm39) probably benign Het
Rasgrp1 T G 2: 117,115,428 (GRCm39) K685T probably benign Het
Rnf148 C T 6: 23,654,237 (GRCm39) R253Q probably damaging Het
Rock1 T C 18: 10,132,227 (GRCm39) I241V possibly damaging Het
Rp1l1 T G 14: 64,259,541 (GRCm39) V61G probably damaging Het
Scin A C 12: 40,131,770 (GRCm39) S255A probably damaging Het
Scn8a A T 15: 100,933,505 (GRCm39) K1570* probably null Het
Sec14l4 A C 11: 3,990,018 (GRCm39) M106L probably benign Het
Sec63 G A 10: 42,674,795 (GRCm39) R226H probably benign Het
Septin2 T A 1: 93,429,345 (GRCm39) N271K probably damaging Het
Serac1 G T 17: 6,099,101 (GRCm39) probably benign Het
Shc2 T A 10: 79,465,974 (GRCm39) probably benign Het
Sipa1l1 T A 12: 82,471,873 (GRCm39) D1284E probably benign Het
Slc11a2 A G 15: 100,306,097 (GRCm39) L105P probably damaging Het
Slc1a3 T A 15: 8,680,406 (GRCm39) T151S probably benign Het
Smarca2 G T 19: 26,668,762 (GRCm39) K920N probably damaging Het
Sugp2 G A 8: 70,711,598 (GRCm39) E964K probably damaging Het
Tas2r122 A C 6: 132,688,778 (GRCm39) N38K probably benign Het
Tecpr1 G A 5: 144,143,092 (GRCm39) R730C probably damaging Het
Tent2 A T 13: 93,312,123 (GRCm39) probably benign Het
Themis3 G T 17: 66,900,265 (GRCm39) N34K possibly damaging Het
Traf3ip1 A G 1: 91,427,341 (GRCm39) T104A unknown Het
Trappc11 A G 8: 47,956,447 (GRCm39) V843A probably benign Het
Trmt61a T A 12: 111,645,361 (GRCm39) L99Q probably damaging Het
Trp53tg5 T A 2: 164,313,401 (GRCm39) K91N probably damaging Het
Ufsp2 T C 8: 46,445,187 (GRCm39) S339P probably damaging Het
Usp20 T A 2: 30,894,462 (GRCm39) V126E probably damaging Het
Vmn1r75 T A 7: 11,614,797 (GRCm39) N176K probably damaging Het
Vmn2r24 A G 6: 123,793,012 (GRCm39) S780G probably benign Het
Vmn2r89 A G 14: 51,695,048 (GRCm39) probably null Het
Vps13d A T 4: 144,771,665 (GRCm39) S4038T probably damaging Het
Vwa7 A G 17: 35,241,627 (GRCm39) T421A probably damaging Het
Wdr95 C A 5: 149,504,271 (GRCm39) L332I probably damaging Het
Wrn T A 8: 33,826,119 (GRCm39) K181I probably damaging Het
Zc3h6 T A 2: 128,859,143 (GRCm39) I1058N possibly damaging Het
Zfp423 T A 8: 88,508,713 (GRCm39) I544F probably damaging Het
Zfp446 T A 7: 12,713,516 (GRCm39) S161T possibly damaging Het
Zmym6 T A 4: 127,017,162 (GRCm39) M889K probably benign Het
Other mutations in Kif1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Kif1a APN 1 92,982,656 (GRCm39) missense probably damaging 1.00
IGL01574:Kif1a APN 1 93,010,062 (GRCm39) missense probably damaging 1.00
IGL01637:Kif1a APN 1 92,967,575 (GRCm39) missense possibly damaging 0.95
IGL01895:Kif1a APN 1 92,953,455 (GRCm39) missense possibly damaging 0.65
IGL02215:Kif1a APN 1 92,948,271 (GRCm39) missense probably benign 0.05
IGL02571:Kif1a APN 1 92,948,178 (GRCm39) critical splice donor site probably null
IGL02734:Kif1a APN 1 92,990,280 (GRCm39) missense probably damaging 1.00
IGL02752:Kif1a APN 1 92,967,569 (GRCm39) missense possibly damaging 0.92
IGL02990:Kif1a APN 1 92,966,985 (GRCm39) missense probably damaging 1.00
IGL03298:Kif1a APN 1 92,993,903 (GRCm39) missense probably damaging 1.00
IGL03309:Kif1a APN 1 92,986,579 (GRCm39) nonsense probably null
IGL03354:Kif1a APN 1 92,987,957 (GRCm39) missense probably damaging 1.00
asbestos UTSW 1 92,950,227 (GRCm39) missense probably damaging 1.00
chrysolite UTSW 1 93,002,670 (GRCm39) splice site probably benign
osmium UTSW 1 92,986,532 (GRCm39) splice site probably benign
R4538_Kif1a_397 UTSW 1 93,004,769 (GRCm39) missense probably damaging 1.00
1mM(1):Kif1a UTSW 1 93,004,790 (GRCm39) missense probably benign 0.00
IGL03046:Kif1a UTSW 1 93,010,128 (GRCm39) missense probably damaging 1.00
PIT4508001:Kif1a UTSW 1 92,974,451 (GRCm39) missense probably damaging 1.00
R0025:Kif1a UTSW 1 92,970,080 (GRCm39) missense probably damaging 1.00
R0115:Kif1a UTSW 1 92,974,500 (GRCm39) splice site probably benign
R0243:Kif1a UTSW 1 92,969,815 (GRCm39) missense probably damaging 1.00
R0270:Kif1a UTSW 1 92,982,164 (GRCm39) splice site probably benign
R0335:Kif1a UTSW 1 92,980,288 (GRCm39) splice site probably benign
R0380:Kif1a UTSW 1 92,983,753 (GRCm39) critical splice acceptor site probably null
R0472:Kif1a UTSW 1 92,946,719 (GRCm39) missense probably damaging 0.99
R0501:Kif1a UTSW 1 92,983,967 (GRCm39) missense probably damaging 1.00
R0628:Kif1a UTSW 1 92,947,605 (GRCm39) missense probably damaging 1.00
R0848:Kif1a UTSW 1 92,947,620 (GRCm39) missense probably damaging 1.00
R1110:Kif1a UTSW 1 92,951,175 (GRCm39) splice site probably benign
R1132:Kif1a UTSW 1 92,983,743 (GRCm39) missense probably damaging 0.99
R1387:Kif1a UTSW 1 92,983,672 (GRCm39) splice site probably benign
R1466:Kif1a UTSW 1 92,982,651 (GRCm39) missense possibly damaging 0.68
R1466:Kif1a UTSW 1 92,982,651 (GRCm39) missense possibly damaging 0.68
R1544:Kif1a UTSW 1 93,002,670 (GRCm39) splice site probably benign
R1569:Kif1a UTSW 1 92,986,532 (GRCm39) splice site probably benign
R1802:Kif1a UTSW 1 92,993,871 (GRCm39) missense probably damaging 1.00
R1917:Kif1a UTSW 1 92,946,753 (GRCm39) missense possibly damaging 0.95
R1919:Kif1a UTSW 1 92,946,753 (GRCm39) missense possibly damaging 0.95
R1999:Kif1a UTSW 1 92,988,517 (GRCm39) missense probably damaging 0.98
R2000:Kif1a UTSW 1 92,982,051 (GRCm39) missense probably damaging 0.99
R2276:Kif1a UTSW 1 92,996,199 (GRCm39) splice site probably benign
R2307:Kif1a UTSW 1 93,006,491 (GRCm39) missense probably damaging 1.00
R2919:Kif1a UTSW 1 92,974,464 (GRCm39) missense probably damaging 1.00
R3440:Kif1a UTSW 1 92,964,575 (GRCm39) missense possibly damaging 0.53
R3441:Kif1a UTSW 1 92,964,575 (GRCm39) missense possibly damaging 0.53
R3618:Kif1a UTSW 1 93,004,765 (GRCm39) missense probably null 1.00
R3957:Kif1a UTSW 1 92,953,416 (GRCm39) missense probably damaging 1.00
R4010:Kif1a UTSW 1 92,950,131 (GRCm39) missense probably benign 0.42
R4013:Kif1a UTSW 1 93,004,014 (GRCm39) missense probably damaging 1.00
R4017:Kif1a UTSW 1 93,004,014 (GRCm39) missense probably damaging 1.00
R4115:Kif1a UTSW 1 92,980,260 (GRCm39) missense probably damaging 1.00
R4386:Kif1a UTSW 1 92,996,272 (GRCm39) missense probably damaging 1.00
R4538:Kif1a UTSW 1 93,004,769 (GRCm39) missense probably damaging 1.00
R4608:Kif1a UTSW 1 92,952,368 (GRCm39) missense possibly damaging 0.81
R4625:Kif1a UTSW 1 92,970,381 (GRCm39) missense probably benign 0.00
R4701:Kif1a UTSW 1 93,006,557 (GRCm39) missense probably damaging 0.99
R4794:Kif1a UTSW 1 92,953,449 (GRCm39) missense probably damaging 1.00
R4830:Kif1a UTSW 1 92,948,931 (GRCm39) splice site probably null
R4903:Kif1a UTSW 1 92,949,456 (GRCm39) missense probably damaging 1.00
R4915:Kif1a UTSW 1 93,002,700 (GRCm39) missense probably benign 0.21
R4918:Kif1a UTSW 1 93,002,700 (GRCm39) missense probably benign 0.21
R4991:Kif1a UTSW 1 93,006,530 (GRCm39) missense probably benign 0.00
R5028:Kif1a UTSW 1 92,982,049 (GRCm39) missense possibly damaging 0.68
R5051:Kif1a UTSW 1 93,003,876 (GRCm39) splice site probably null
R5073:Kif1a UTSW 1 92,950,227 (GRCm39) missense probably damaging 1.00
R5103:Kif1a UTSW 1 92,974,418 (GRCm39) missense probably damaging 1.00
R5314:Kif1a UTSW 1 92,946,220 (GRCm39) missense probably damaging 1.00
R5481:Kif1a UTSW 1 92,987,966 (GRCm39) missense probably benign 0.01
R5510:Kif1a UTSW 1 92,969,414 (GRCm39) missense possibly damaging 0.93
R5610:Kif1a UTSW 1 92,953,450 (GRCm39) missense probably damaging 1.00
R5643:Kif1a UTSW 1 92,983,489 (GRCm39) missense probably damaging 0.98
R5808:Kif1a UTSW 1 92,970,420 (GRCm39) missense probably damaging 0.99
R6027:Kif1a UTSW 1 92,953,365 (GRCm39) missense probably benign 0.33
R6056:Kif1a UTSW 1 92,952,370 (GRCm39) missense probably damaging 1.00
R6077:Kif1a UTSW 1 92,982,618 (GRCm39) missense possibly damaging 0.54
R6120:Kif1a UTSW 1 92,952,296 (GRCm39) splice site probably null
R6126:Kif1a UTSW 1 92,947,621 (GRCm39) missense probably damaging 1.00
R6130:Kif1a UTSW 1 92,964,623 (GRCm39) missense probably damaging 1.00
R6255:Kif1a UTSW 1 92,947,705 (GRCm39) missense probably damaging 1.00
R6301:Kif1a UTSW 1 92,982,663 (GRCm39) nonsense probably null
R6326:Kif1a UTSW 1 93,004,048 (GRCm39) missense probably damaging 1.00
R6594:Kif1a UTSW 1 92,949,035 (GRCm39) missense probably benign 0.00
R6653:Kif1a UTSW 1 93,005,420 (GRCm39) missense probably damaging 1.00
R6791:Kif1a UTSW 1 92,993,859 (GRCm39) missense probably damaging 1.00
R6853:Kif1a UTSW 1 92,967,524 (GRCm39) missense possibly damaging 0.47
R7022:Kif1a UTSW 1 92,993,820 (GRCm39) missense probably benign 0.31
R7059:Kif1a UTSW 1 92,974,551 (GRCm39) intron probably benign
R7103:Kif1a UTSW 1 93,005,507 (GRCm39) missense probably damaging 1.00
R7248:Kif1a UTSW 1 92,969,305 (GRCm39) missense probably benign 0.35
R7259:Kif1a UTSW 1 93,001,532 (GRCm39) nonsense probably null
R7424:Kif1a UTSW 1 92,982,039 (GRCm39) missense possibly damaging 0.89
R7659:Kif1a UTSW 1 92,974,542 (GRCm39) intron probably benign
R7681:Kif1a UTSW 1 92,982,666 (GRCm39) missense probably benign
R7976:Kif1a UTSW 1 92,967,496 (GRCm39) missense probably damaging 1.00
R8056:Kif1a UTSW 1 92,982,423 (GRCm39) intron probably benign
R8420:Kif1a UTSW 1 92,950,141 (GRCm39) missense probably benign
R8994:Kif1a UTSW 1 92,983,457 (GRCm39) missense possibly damaging 0.77
R9016:Kif1a UTSW 1 92,953,395 (GRCm39) missense probably damaging 1.00
R9206:Kif1a UTSW 1 92,979,202 (GRCm39) missense probably damaging 0.99
R9246:Kif1a UTSW 1 93,005,501 (GRCm39) missense probably damaging 0.98
R9252:Kif1a UTSW 1 93,002,776 (GRCm39) missense probably damaging 1.00
R9388:Kif1a UTSW 1 93,000,029 (GRCm39) critical splice donor site probably null
R9413:Kif1a UTSW 1 92,949,019 (GRCm39) missense probably benign 0.00
R9612:Kif1a UTSW 1 92,953,416 (GRCm39) missense probably damaging 1.00
R9621:Kif1a UTSW 1 92,983,445 (GRCm39) missense probably benign
R9625:Kif1a UTSW 1 93,000,766 (GRCm39) missense probably benign 0.42
R9694:Kif1a UTSW 1 92,950,173 (GRCm39) missense probably benign
Z1176:Kif1a UTSW 1 92,950,213 (GRCm39) missense probably damaging 1.00
Z1176:Kif1a UTSW 1 92,949,038 (GRCm39) missense probably damaging 0.97
Z1176:Kif1a UTSW 1 92,983,419 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTCTATGCCTTGCTGTGTGAGAC -3'
(R):5'- TAGTGTGCCCTGGTGACTACTGAG -3'

Sequencing Primer
(F):5'- CCAAGTGGGTCCTGATAAACTG -3'
(R):5'- ACTACTGAGTTGCAGGTAGTGATG -3'
Posted On 2013-06-12