Incidental Mutation 'R0538:Nemf'
ID 49617
Institutional Source Beutler Lab
Gene Symbol Nemf
Ensembl Gene ENSMUSG00000020982
Gene Name nuclear export mediator factor
Synonyms Sdccag1, 1500011I12Rik, 4933405E14Rik
MMRRC Submission 038730-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0538 (G1)
Quality Score 196
Status Validated
Chromosome 12
Chromosomal Location 69358315-69403975 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69403088 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 31 (D31E)
Ref Sequence ENSEMBL: ENSMUSP00000152476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021368] [ENSMUST00000220484] [ENSMUST00000222065]
AlphaFold Q8CCP0
Predicted Effect probably damaging
Transcript: ENSMUST00000021368
AA Change: D31E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021368
Gene: ENSMUSG00000020982
AA Change: D31E

DomainStartEndE-ValueType
Pfam:FbpA 6 523 5.5e-42 PFAM
Pfam:DUF814 530 630 9e-27 PFAM
low complexity region 697 708 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
low complexity region 894 918 N/A INTRINSIC
Pfam:DUF3441 956 1055 9.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200291
Predicted Effect possibly damaging
Transcript: ENSMUST00000220484
AA Change: D31E

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220674
Predicted Effect probably damaging
Transcript: ENSMUST00000222065
AA Change: D31E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220959
Meta Mutation Damage Score 0.2196 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the ribosome quality control complex. The encoded protein facilitates the recognition and ubiquitination of stalled 60S subunits by the ubiquitin ligase listerin. A similar protein in fly functions as a tumor suppressor. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 67,175,823 (GRCm39) H6L unknown Het
Abca13 G A 11: 9,217,622 (GRCm39) probably null Het
Acad12 C T 5: 121,745,511 (GRCm39) R260Q possibly damaging Het
Actn1 G A 12: 80,306,874 (GRCm39) probably benign Het
Acvrl1 A G 15: 101,034,030 (GRCm39) T182A probably damaging Het
Adam23 T C 1: 63,607,003 (GRCm39) probably benign Het
Adamtsl1 A T 4: 86,261,358 (GRCm39) T1190S probably benign Het
Adh6b A T 3: 138,063,411 (GRCm39) Y330F probably benign Het
Ak7 A G 12: 105,732,876 (GRCm39) E540G probably damaging Het
Akr1c19 T A 13: 4,287,099 (GRCm39) L106Q probably damaging Het
Ankrd12 A T 17: 66,356,847 (GRCm39) S57T probably damaging Het
Aoc3 G A 11: 101,222,964 (GRCm39) R400Q possibly damaging Het
Arel1 A T 12: 84,988,611 (GRCm39) I46N probably damaging Het
Armc5 A G 7: 127,843,463 (GRCm39) D752G probably damaging Het
Atp11b T C 3: 35,891,163 (GRCm39) V812A probably damaging Het
Axin1 A G 17: 26,403,215 (GRCm39) H131R possibly damaging Het
Bpifb3 A G 2: 153,765,789 (GRCm39) E184G probably benign Het
Cacna2d2 T C 9: 107,401,582 (GRCm39) probably benign Het
Catsperd T C 17: 56,969,828 (GRCm39) F641L probably benign Het
Ccdc83 A C 7: 89,877,591 (GRCm39) L284V probably damaging Het
Ccn2 T A 10: 24,472,364 (GRCm39) C136S probably damaging Het
Ccnt2 T A 1: 127,730,902 (GRCm39) V593E probably damaging Het
Cd53 T A 3: 106,669,444 (GRCm39) I185F probably benign Het
Cep350 A T 1: 155,724,366 (GRCm39) D3077E possibly damaging Het
Ces1h C A 8: 94,083,628 (GRCm39) probably null Het
Chrna3 T A 9: 54,923,290 (GRCm39) T173S probably benign Het
Clca4b T C 3: 144,627,717 (GRCm39) D418G probably benign Het
Col11a2 T C 17: 34,270,302 (GRCm39) probably benign Het
Coq2 T A 5: 100,815,889 (GRCm39) I97F possibly damaging Het
Cr2 A G 1: 194,842,667 (GRCm39) probably benign Het
D2hgdh A G 1: 93,754,099 (GRCm39) Y24C probably damaging Het
D630045J12Rik G A 6: 38,168,628 (GRCm39) R974C probably damaging Het
Dach1 A G 14: 98,140,715 (GRCm39) V429A possibly damaging Het
Ddr1 G A 17: 35,995,899 (GRCm39) T660I probably damaging Het
Dlg1 A C 16: 31,615,682 (GRCm39) probably null Het
Dmbt1 T C 7: 130,651,631 (GRCm39) probably benign Het
Dmxl2 A T 9: 54,301,120 (GRCm39) D2330E probably benign Het
Dnai4 T C 4: 102,953,815 (GRCm39) N128S possibly damaging Het
Doc2a A G 7: 126,447,983 (GRCm39) T5A probably benign Het
Dock2 G A 11: 34,595,545 (GRCm39) probably benign Het
Dok4 T A 8: 95,591,866 (GRCm39) Y290F probably damaging Het
Dop1a A G 9: 86,367,550 (GRCm39) D11G probably damaging Het
E230025N22Rik T C 18: 36,821,987 (GRCm39) H235R probably benign Het
Ear6 A G 14: 52,091,909 (GRCm39) D152G probably damaging Het
Ecscr T A 18: 35,846,689 (GRCm39) probably benign Het
Eml6 A T 11: 29,710,010 (GRCm39) probably benign Het
Epha4 T A 1: 77,365,178 (GRCm39) Q607L probably damaging Het
Exoc4 A G 6: 33,948,998 (GRCm39) N947S probably benign Het
Flg A G 3: 93,186,767 (GRCm39) E73G probably damaging Het
Fndc1 C T 17: 8,003,173 (GRCm39) probably benign Het
Gad1-ps T C 10: 99,280,854 (GRCm39) noncoding transcript Het
Gata6 A G 18: 11,064,771 (GRCm39) T528A probably benign Het
Gjd4 T C 18: 9,280,244 (GRCm39) E278G probably benign Het
Gm20091 T A 10: 96,244,864 (GRCm39) noncoding transcript Het
Gnb3 G A 6: 124,812,659 (GRCm39) Q266* probably null Het
Grm3 A G 5: 9,562,446 (GRCm39) V468A possibly damaging Het
Igf1r C T 7: 67,857,574 (GRCm39) R1085C probably damaging Het
Igsf10 T C 3: 59,227,527 (GRCm39) T2049A probably damaging Het
Jak3 A T 8: 72,138,126 (GRCm39) D859V probably benign Het
Kcnb2 G T 1: 15,783,108 (GRCm39) probably benign Het
Kcnh3 G A 15: 99,138,839 (GRCm39) G858D probably benign Het
Kif1a C A 1: 92,971,360 (GRCm39) R1006L probably damaging Het
Klhl23 C T 2: 69,654,757 (GRCm39) A209V probably benign Het
Mapk13 T C 17: 28,994,229 (GRCm39) Y104H probably damaging Het
Mbd4 A G 6: 115,826,443 (GRCm39) S183P probably damaging Het
Mga T C 2: 119,750,187 (GRCm39) probably null Het
Mipol1 G A 12: 57,461,197 (GRCm39) probably null Het
Mmp14 A G 14: 54,676,166 (GRCm39) T299A possibly damaging Het
Mmrn1 A G 6: 60,953,453 (GRCm39) E578G probably benign Het
Mov10l1 G A 15: 88,879,063 (GRCm39) C193Y possibly damaging Het
Mppe1 A G 18: 67,370,548 (GRCm39) C50R probably damaging Het
Msantd1 C A 5: 35,075,069 (GRCm39) R44S probably damaging Het
Myt1l T C 12: 29,892,570 (GRCm39) V69A possibly damaging Het
Nav1 A T 1: 135,392,430 (GRCm39) probably benign Het
Ncan A G 8: 70,561,252 (GRCm39) S572P possibly damaging Het
Nck2 T C 1: 43,608,304 (GRCm39) probably benign Het
Nlrp12 T C 7: 3,297,892 (GRCm39) D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 (GRCm39) probably null Het
Nup98 T C 7: 101,835,892 (GRCm39) T184A probably damaging Het
Oog2 C A 4: 143,922,654 (GRCm39) Y306* probably null Het
Or13a18 A T 7: 140,190,297 (GRCm39) N73Y probably damaging Het
Or6ae1 A T 7: 139,742,144 (GRCm39) S240T probably damaging Het
Or6b2b A T 1: 92,419,055 (GRCm39) C141S possibly damaging Het
Osmr A G 15: 6,871,419 (GRCm39) probably benign Het
P2rx6 A G 16: 17,386,162 (GRCm39) N275S probably benign Het
Pbxip1 G T 3: 89,354,926 (GRCm39) G482W possibly damaging Het
Pcsk4 T G 10: 80,161,168 (GRCm39) I249L probably damaging Het
Pou4f2 C T 8: 79,162,291 (GRCm39) G104E probably damaging Het
Pramel28 T A 4: 143,691,653 (GRCm39) T357S possibly damaging Het
Prkdc G T 16: 15,651,652 (GRCm39) R3763L probably damaging Het
Ptpre A T 7: 135,265,044 (GRCm39) I207F probably damaging Het
Rapgef3 A T 15: 97,655,698 (GRCm39) probably benign Het
Rasgrp1 T G 2: 117,115,428 (GRCm39) K685T probably benign Het
Rnf148 C T 6: 23,654,237 (GRCm39) R253Q probably damaging Het
Rock1 T C 18: 10,132,227 (GRCm39) I241V possibly damaging Het
Rp1l1 T G 14: 64,259,541 (GRCm39) V61G probably damaging Het
Scin A C 12: 40,131,770 (GRCm39) S255A probably damaging Het
Scn8a A T 15: 100,933,505 (GRCm39) K1570* probably null Het
Sec14l4 A C 11: 3,990,018 (GRCm39) M106L probably benign Het
Sec63 G A 10: 42,674,795 (GRCm39) R226H probably benign Het
Septin2 T A 1: 93,429,345 (GRCm39) N271K probably damaging Het
Serac1 G T 17: 6,099,101 (GRCm39) probably benign Het
Shc2 T A 10: 79,465,974 (GRCm39) probably benign Het
Sipa1l1 T A 12: 82,471,873 (GRCm39) D1284E probably benign Het
Slc11a2 A G 15: 100,306,097 (GRCm39) L105P probably damaging Het
Slc1a3 T A 15: 8,680,406 (GRCm39) T151S probably benign Het
Smarca2 G T 19: 26,668,762 (GRCm39) K920N probably damaging Het
Sugp2 G A 8: 70,711,598 (GRCm39) E964K probably damaging Het
Tas2r122 A C 6: 132,688,778 (GRCm39) N38K probably benign Het
Tecpr1 G A 5: 144,143,092 (GRCm39) R730C probably damaging Het
Tent2 A T 13: 93,312,123 (GRCm39) probably benign Het
Themis3 G T 17: 66,900,265 (GRCm39) N34K possibly damaging Het
Traf3ip1 A G 1: 91,427,341 (GRCm39) T104A unknown Het
Trappc11 A G 8: 47,956,447 (GRCm39) V843A probably benign Het
Trmt61a T A 12: 111,645,361 (GRCm39) L99Q probably damaging Het
Trp53tg5 T A 2: 164,313,401 (GRCm39) K91N probably damaging Het
Ufsp2 T C 8: 46,445,187 (GRCm39) S339P probably damaging Het
Usp20 T A 2: 30,894,462 (GRCm39) V126E probably damaging Het
Vmn1r75 T A 7: 11,614,797 (GRCm39) N176K probably damaging Het
Vmn2r24 A G 6: 123,793,012 (GRCm39) S780G probably benign Het
Vmn2r89 A G 14: 51,695,048 (GRCm39) probably null Het
Vps13d A T 4: 144,771,665 (GRCm39) S4038T probably damaging Het
Vwa7 A G 17: 35,241,627 (GRCm39) T421A probably damaging Het
Wdr95 C A 5: 149,504,271 (GRCm39) L332I probably damaging Het
Wrn T A 8: 33,826,119 (GRCm39) K181I probably damaging Het
Zc3h6 T A 2: 128,859,143 (GRCm39) I1058N possibly damaging Het
Zfp423 T A 8: 88,508,713 (GRCm39) I544F probably damaging Het
Zfp446 T A 7: 12,713,516 (GRCm39) S161T possibly damaging Het
Zmym6 T A 4: 127,017,162 (GRCm39) M889K probably benign Het
Other mutations in Nemf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Nemf APN 12 69,391,760 (GRCm39) splice site probably benign
IGL02499:Nemf APN 12 69,368,903 (GRCm39) missense probably damaging 1.00
IGL03352:Nemf APN 12 69,378,679 (GRCm39) missense probably damaging 1.00
kaempfer UTSW 12 69,399,110 (GRCm39) missense probably benign 0.01
R0335:Nemf UTSW 12 69,400,577 (GRCm39) missense probably benign 0.16
R0581:Nemf UTSW 12 69,369,045 (GRCm39) missense probably benign
R0909:Nemf UTSW 12 69,388,384 (GRCm39) missense probably damaging 1.00
R1792:Nemf UTSW 12 69,359,343 (GRCm39) missense probably damaging 1.00
R1899:Nemf UTSW 12 69,393,152 (GRCm39) missense probably null
R2080:Nemf UTSW 12 69,400,560 (GRCm39) splice site probably benign
R3704:Nemf UTSW 12 69,377,904 (GRCm39) missense probably damaging 1.00
R3842:Nemf UTSW 12 69,378,723 (GRCm39) missense probably damaging 0.98
R4471:Nemf UTSW 12 69,361,216 (GRCm39) missense probably benign 0.04
R4666:Nemf UTSW 12 69,359,054 (GRCm39) missense probably damaging 1.00
R4720:Nemf UTSW 12 69,371,062 (GRCm39) missense probably benign 0.05
R5198:Nemf UTSW 12 69,402,821 (GRCm39) missense probably damaging 1.00
R5474:Nemf UTSW 12 69,363,109 (GRCm39) missense probably benign 0.03
R6893:Nemf UTSW 12 69,399,110 (GRCm39) missense probably benign 0.01
R7008:Nemf UTSW 12 69,400,567 (GRCm39) critical splice donor site probably null
R7008:Nemf UTSW 12 69,388,395 (GRCm39) missense possibly damaging 0.91
R7098:Nemf UTSW 12 69,359,241 (GRCm39) missense probably damaging 1.00
R7154:Nemf UTSW 12 69,363,515 (GRCm39) critical splice donor site probably null
R7452:Nemf UTSW 12 69,384,733 (GRCm39) splice site probably null
R8130:Nemf UTSW 12 69,402,826 (GRCm39) missense possibly damaging 0.91
R8340:Nemf UTSW 12 69,400,659 (GRCm39) missense possibly damaging 0.94
R8914:Nemf UTSW 12 69,363,089 (GRCm39) nonsense probably null
R9089:Nemf UTSW 12 69,400,628 (GRCm39) missense probably damaging 1.00
R9150:Nemf UTSW 12 69,387,820 (GRCm39) missense probably benign 0.00
R9228:Nemf UTSW 12 69,388,093 (GRCm39) missense probably damaging 1.00
R9644:Nemf UTSW 12 69,359,436 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CATGGCAAAACTCGACGGCATC -3'
(R):5'- CTTCCCAAAGAGAAGTAGCAGGGC -3'

Sequencing Primer
(F):5'- AACTCGACGGCATCATGTTC -3'
(R):5'- gacctgtgtcctggacttg -3'
Posted On 2013-06-12