Incidental Mutation 'R0538:Rp1l1'
ID 49627
Institutional Source Beutler Lab
Gene Symbol Rp1l1
Ensembl Gene ENSMUSG00000046049
Gene Name retinitis pigmentosa 1 homolog like 1
Synonyms Dcdc4, Rp1hl1
MMRRC Submission 038730-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R0538 (G1)
Quality Score 129
Status Validated
Chromosome 14
Chromosomal Location 63992506-64035025 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 64022092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 61 (V61G)
Ref Sequence ENSEMBL: ENSMUSP00000055449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058229]
AlphaFold Q8CGM2
Predicted Effect probably damaging
Transcript: ENSMUST00000058229
AA Change: V61G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055449
Gene: ENSMUSG00000046049
AA Change: V61G

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
DCX 37 121 1.58e-13 SMART
DCX 155 239 1e-15 SMART
low complexity region 709 728 N/A INTRINSIC
low complexity region 870 884 N/A INTRINSIC
low complexity region 1159 1177 N/A INTRINSIC
low complexity region 1228 1239 N/A INTRINSIC
low complexity region 1612 1618 N/A INTRINSIC
low complexity region 1642 1652 N/A INTRINSIC
Meta Mutation Damage Score 0.1904 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. This protein is a retinal-specific protein. It contains two N-terminal doublecortin domains, which can assemble and stabilize axonemal microtubules, but lacks the C-terminal repetitive regions including the 16aa repeat found in human RP1L1. This protein and the RP1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit retinal photoreceptor abnormalities, including scattered outer segment disorganization, reduced electroretinogram amplitudes, and progressive retinal rod cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 66,938,374 (GRCm38) H6L unknown Het
Abca13 G A 11: 9,267,622 (GRCm38) probably null Het
Acad12 C T 5: 121,607,448 (GRCm38) R260Q possibly damaging Het
Actn1 G A 12: 80,260,100 (GRCm38) probably benign Het
Acvrl1 A G 15: 101,136,149 (GRCm38) T182A probably damaging Het
Adam23 T C 1: 63,567,844 (GRCm38) probably benign Het
Adamtsl1 A T 4: 86,343,121 (GRCm38) T1190S probably benign Het
Adh6b A T 3: 138,357,650 (GRCm38) Y330F probably benign Het
Ak7 A G 12: 105,766,617 (GRCm38) E540G probably damaging Het
Akr1c19 T A 13: 4,237,100 (GRCm38) L106Q probably damaging Het
Ankrd12 A T 17: 66,049,852 (GRCm38) S57T probably damaging Het
Aoc3 G A 11: 101,332,138 (GRCm38) R400Q possibly damaging Het
Arel1 A T 12: 84,941,837 (GRCm38) I46N probably damaging Het
Armc5 A G 7: 128,244,291 (GRCm38) D752G probably damaging Het
Atp11b T C 3: 35,837,014 (GRCm38) V812A probably damaging Het
Axin1 A G 17: 26,184,241 (GRCm38) H131R possibly damaging Het
Bpifb3 A G 2: 153,923,869 (GRCm38) E184G probably benign Het
Cacna2d2 T C 9: 107,524,383 (GRCm38) probably benign Het
Catsperd T C 17: 56,662,828 (GRCm38) F641L probably benign Het
Ccdc83 A C 7: 90,228,383 (GRCm38) L284V probably damaging Het
Ccnt2 T A 1: 127,803,165 (GRCm38) V593E probably damaging Het
Cd53 T A 3: 106,762,128 (GRCm38) I185F probably benign Het
Cep350 A T 1: 155,848,620 (GRCm38) D3077E possibly damaging Het
Ces1h C A 8: 93,357,000 (GRCm38) probably null Het
Chrna3 T A 9: 55,016,006 (GRCm38) T173S probably benign Het
Clca4b T C 3: 144,921,956 (GRCm38) D418G probably benign Het
Col11a2 T C 17: 34,051,328 (GRCm38) probably benign Het
Coq2 T A 5: 100,668,023 (GRCm38) I97F possibly damaging Het
Cr2 A G 1: 195,160,359 (GRCm38) probably benign Het
Ctgf T A 10: 24,596,466 (GRCm38) C136S probably damaging Het
D2hgdh A G 1: 93,826,377 (GRCm38) Y24C probably damaging Het
D630045J12Rik G A 6: 38,191,693 (GRCm38) R974C probably damaging Het
Dach1 A G 14: 97,903,279 (GRCm38) V429A possibly damaging Het
Ddr1 G A 17: 35,685,007 (GRCm38) T660I probably damaging Het
Dlg1 A C 16: 31,796,864 (GRCm38) probably null Het
Dmbt1 T C 7: 131,049,901 (GRCm38) probably benign Het
Dmxl2 A T 9: 54,393,836 (GRCm38) D2330E probably benign Het
Doc2a A G 7: 126,848,811 (GRCm38) T5A probably benign Het
Dock2 G A 11: 34,704,718 (GRCm38) probably benign Het
Dok4 T A 8: 94,865,238 (GRCm38) Y290F probably damaging Het
Dopey1 A G 9: 86,485,497 (GRCm38) D11G probably damaging Het
E230025N22Rik T C 18: 36,688,934 (GRCm38) H235R probably benign Het
Ear6 A G 14: 51,854,452 (GRCm38) D152G probably damaging Het
Ecscr T A 18: 35,713,636 (GRCm38) probably benign Het
Eml6 A T 11: 29,760,010 (GRCm38) probably benign Het
Epha4 T A 1: 77,388,541 (GRCm38) Q607L probably damaging Het
Exoc4 A G 6: 33,972,063 (GRCm38) N947S probably benign Het
Flg A G 3: 93,279,460 (GRCm38) E73G probably damaging Het
Fndc1 C T 17: 7,784,341 (GRCm38) probably benign Het
Gad1-ps T C 10: 99,444,992 (GRCm38) noncoding transcript Het
Gata6 A G 18: 11,064,771 (GRCm38) T528A probably benign Het
Gjd4 T C 18: 9,280,244 (GRCm38) E278G probably benign Het
Gm13101 T A 4: 143,965,083 (GRCm38) T357S possibly damaging Het
Gm20091 T A 10: 96,409,002 (GRCm38) noncoding transcript Het
Gnb3 G A 6: 124,835,696 (GRCm38) Q266* probably null Het
Grm3 A G 5: 9,512,446 (GRCm38) V468A possibly damaging Het
Igf1r C T 7: 68,207,826 (GRCm38) R1085C probably damaging Het
Igsf10 T C 3: 59,320,106 (GRCm38) T2049A probably damaging Het
Jak3 A T 8: 71,685,482 (GRCm38) D859V probably benign Het
Kcnb2 G T 1: 15,712,884 (GRCm38) probably benign Het
Kcnh3 G A 15: 99,240,958 (GRCm38) G858D probably benign Het
Kif1a C A 1: 93,043,638 (GRCm38) R1006L probably damaging Het
Klhl23 C T 2: 69,824,413 (GRCm38) A209V probably benign Het
Mapk13 T C 17: 28,775,255 (GRCm38) Y104H probably damaging Het
Mbd4 A G 6: 115,849,482 (GRCm38) S183P probably damaging Het
Mga T C 2: 119,919,706 (GRCm38) probably null Het
Mipol1 G A 12: 57,414,411 (GRCm38) probably null Het
Mmp14 A G 14: 54,438,709 (GRCm38) T299A possibly damaging Het
Mmrn1 A G 6: 60,976,469 (GRCm38) E578G probably benign Het
Mov10l1 G A 15: 88,994,860 (GRCm38) C193Y possibly damaging Het
Mppe1 A G 18: 67,237,477 (GRCm38) C50R probably damaging Het
Msantd1 C A 5: 34,917,725 (GRCm38) R44S probably damaging Het
Myt1l T C 12: 29,842,571 (GRCm38) V69A possibly damaging Het
Nav1 A T 1: 135,464,692 (GRCm38) probably benign Het
Ncan A G 8: 70,108,602 (GRCm38) S572P possibly damaging Het
Nck2 T C 1: 43,569,144 (GRCm38) probably benign Het
Nemf A T 12: 69,356,314 (GRCm38) D31E probably damaging Het
Nlrp12 T C 7: 3,249,262 (GRCm38) D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 (GRCm38) probably null Het
Nup98 T C 7: 102,186,685 (GRCm38) T184A probably damaging Het
Olfr1415 A T 1: 92,491,333 (GRCm38) C141S possibly damaging Het
Olfr46 A T 7: 140,610,384 (GRCm38) N73Y probably damaging Het
Olfr522 A T 7: 140,162,231 (GRCm38) S240T probably damaging Het
Oog2 C A 4: 144,196,084 (GRCm38) Y306* probably null Het
Osmr A G 15: 6,841,938 (GRCm38) probably benign Het
P2rx6 A G 16: 17,568,298 (GRCm38) N275S probably benign Het
Papd4 A T 13: 93,175,615 (GRCm38) probably benign Het
Pbxip1 G T 3: 89,447,619 (GRCm38) G482W possibly damaging Het
Pcsk4 T G 10: 80,325,334 (GRCm38) I249L probably damaging Het
Pou4f2 C T 8: 78,435,662 (GRCm38) G104E probably damaging Het
Prkdc G T 16: 15,833,788 (GRCm38) R3763L probably damaging Het
Ptpre A T 7: 135,663,315 (GRCm38) I207F probably damaging Het
Rapgef3 A T 15: 97,757,817 (GRCm38) probably benign Het
Rasgrp1 T G 2: 117,284,947 (GRCm38) K685T probably benign Het
Rnf148 C T 6: 23,654,238 (GRCm38) R253Q probably damaging Het
Rock1 T C 18: 10,132,227 (GRCm38) I241V possibly damaging Het
Scin A C 12: 40,081,771 (GRCm38) S255A probably damaging Het
Scn8a A T 15: 101,035,624 (GRCm38) K1570* probably null Het
Sec14l4 A C 11: 4,040,018 (GRCm38) M106L probably benign Het
Sec63 G A 10: 42,798,799 (GRCm38) R226H probably benign Het
Sept2 T A 1: 93,501,623 (GRCm38) N271K probably damaging Het
Serac1 G T 17: 6,048,826 (GRCm38) probably benign Het
Shc2 T A 10: 79,630,140 (GRCm38) probably benign Het
Sipa1l1 T A 12: 82,425,099 (GRCm38) D1284E probably benign Het
Slc11a2 A G 15: 100,408,216 (GRCm38) L105P probably damaging Het
Slc1a3 T A 15: 8,650,922 (GRCm38) T151S probably benign Het
Smarca2 G T 19: 26,691,362 (GRCm38) K920N probably damaging Het
Sugp2 G A 8: 70,258,948 (GRCm38) E964K probably damaging Het
Tas2r122 A C 6: 132,711,815 (GRCm38) N38K probably benign Het
Tecpr1 G A 5: 144,206,274 (GRCm38) R730C probably damaging Het
Themis3 G T 17: 66,593,270 (GRCm38) N34K possibly damaging Het
Traf3ip1 A G 1: 91,499,619 (GRCm38) T104A unknown Het
Trappc11 A G 8: 47,503,412 (GRCm38) V843A probably benign Het
Trmt61a T A 12: 111,678,927 (GRCm38) L99Q probably damaging Het
Trp53tg5 T A 2: 164,471,481 (GRCm38) K91N probably damaging Het
Ufsp2 T C 8: 45,992,150 (GRCm38) S339P probably damaging Het
Usp20 T A 2: 31,004,450 (GRCm38) V126E probably damaging Het
Vmn1r75 T A 7: 11,880,870 (GRCm38) N176K probably damaging Het
Vmn2r24 A G 6: 123,816,053 (GRCm38) S780G probably benign Het
Vmn2r89 A G 14: 51,457,591 (GRCm38) probably null Het
Vps13d A T 4: 145,045,095 (GRCm38) S4038T probably damaging Het
Vwa7 A G 17: 35,022,651 (GRCm38) T421A probably damaging Het
Wdr78 T C 4: 103,096,618 (GRCm38) N128S possibly damaging Het
Wdr95 C A 5: 149,580,806 (GRCm38) L332I probably damaging Het
Wrn T A 8: 33,336,091 (GRCm38) K181I probably damaging Het
Zc3h6 T A 2: 129,017,223 (GRCm38) I1058N possibly damaging Het
Zfp423 T A 8: 87,782,085 (GRCm38) I544F probably damaging Het
Zfp446 T A 7: 12,979,589 (GRCm38) S161T possibly damaging Het
Zmym6 T A 4: 127,123,369 (GRCm38) M889K probably benign Het
Other mutations in Rp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Rp1l1 APN 14 64,028,725 (GRCm38) missense probably benign 0.01
IGL02063:Rp1l1 APN 14 64,029,536 (GRCm38) missense probably damaging 0.99
IGL02132:Rp1l1 APN 14 64,028,810 (GRCm38) missense probably benign
IGL02430:Rp1l1 APN 14 64,029,286 (GRCm38) missense probably benign 0.00
IGL02977:Rp1l1 APN 14 64,028,150 (GRCm38) missense probably benign 0.01
IGL03213:Rp1l1 APN 14 64,028,415 (GRCm38) missense probably damaging 0.98
IGL03346:Rp1l1 APN 14 64,029,440 (GRCm38) missense probably benign
R0085:Rp1l1 UTSW 14 64,022,295 (GRCm38) missense probably damaging 0.99
R0347:Rp1l1 UTSW 14 64,030,804 (GRCm38) nonsense probably null
R0362:Rp1l1 UTSW 14 64,031,066 (GRCm38) nonsense probably null
R0369:Rp1l1 UTSW 14 64,029,388 (GRCm38) missense possibly damaging 0.84
R0544:Rp1l1 UTSW 14 64,032,066 (GRCm38) missense probably benign 0.00
R0780:Rp1l1 UTSW 14 64,030,351 (GRCm38) missense possibly damaging 0.94
R0944:Rp1l1 UTSW 14 64,032,232 (GRCm38) missense probably benign 0.05
R1051:Rp1l1 UTSW 14 64,032,535 (GRCm38) missense probably damaging 0.99
R1126:Rp1l1 UTSW 14 64,030,469 (GRCm38) missense probably damaging 1.00
R1450:Rp1l1 UTSW 14 64,028,150 (GRCm38) missense probably benign 0.01
R1483:Rp1l1 UTSW 14 64,029,047 (GRCm38) missense possibly damaging 0.76
R1508:Rp1l1 UTSW 14 64,030,892 (GRCm38) missense possibly damaging 0.83
R1553:Rp1l1 UTSW 14 64,031,894 (GRCm38) missense probably benign 0.00
R1651:Rp1l1 UTSW 14 64,030,993 (GRCm38) missense probably damaging 0.97
R1682:Rp1l1 UTSW 14 64,028,968 (GRCm38) missense probably damaging 0.98
R1809:Rp1l1 UTSW 14 64,027,966 (GRCm38) missense probably benign 0.18
R1885:Rp1l1 UTSW 14 64,028,390 (GRCm38) missense probably benign 0.01
R1887:Rp1l1 UTSW 14 64,028,390 (GRCm38) missense probably benign 0.01
R1898:Rp1l1 UTSW 14 64,031,590 (GRCm38) missense probably benign 0.04
R1924:Rp1l1 UTSW 14 64,031,543 (GRCm38) missense probably benign
R1939:Rp1l1 UTSW 14 64,029,593 (GRCm38) missense probably benign
R1941:Rp1l1 UTSW 14 64,022,252 (GRCm38) missense probably damaging 1.00
R2129:Rp1l1 UTSW 14 64,028,966 (GRCm38) missense possibly damaging 0.93
R2363:Rp1l1 UTSW 14 64,029,998 (GRCm38) missense possibly damaging 0.55
R3894:Rp1l1 UTSW 14 64,029,307 (GRCm38) missense probably benign
R3974:Rp1l1 UTSW 14 64,030,309 (GRCm38) missense probably damaging 1.00
R3975:Rp1l1 UTSW 14 64,030,309 (GRCm38) missense probably damaging 1.00
R3976:Rp1l1 UTSW 14 64,030,309 (GRCm38) missense probably damaging 1.00
R4072:Rp1l1 UTSW 14 64,028,132 (GRCm38) missense probably damaging 1.00
R4672:Rp1l1 UTSW 14 64,031,270 (GRCm38) missense probably damaging 1.00
R4673:Rp1l1 UTSW 14 64,031,270 (GRCm38) missense probably damaging 1.00
R4749:Rp1l1 UTSW 14 64,029,800 (GRCm38) missense probably damaging 0.99
R4755:Rp1l1 UTSW 14 64,030,070 (GRCm38) missense probably benign 0.34
R4877:Rp1l1 UTSW 14 64,026,171 (GRCm38) missense probably benign 0.00
R4930:Rp1l1 UTSW 14 64,032,206 (GRCm38) missense probably benign
R5039:Rp1l1 UTSW 14 64,031,356 (GRCm38) missense probably benign 0.21
R5106:Rp1l1 UTSW 14 64,027,946 (GRCm38) missense probably damaging 1.00
R5184:Rp1l1 UTSW 14 64,030,180 (GRCm38) missense probably damaging 1.00
R5215:Rp1l1 UTSW 14 64,030,013 (GRCm38) missense probably benign 0.01
R5409:Rp1l1 UTSW 14 64,030,621 (GRCm38) missense probably benign 0.02
R5575:Rp1l1 UTSW 14 64,030,984 (GRCm38) missense probably benign 0.23
R5696:Rp1l1 UTSW 14 64,029,746 (GRCm38) missense probably damaging 0.99
R5739:Rp1l1 UTSW 14 64,032,170 (GRCm38) missense probably benign 0.01
R5878:Rp1l1 UTSW 14 64,028,906 (GRCm38) missense probably benign 0.09
R6133:Rp1l1 UTSW 14 64,030,096 (GRCm38) missense probably damaging 1.00
R6134:Rp1l1 UTSW 14 64,030,096 (GRCm38) missense probably damaging 1.00
R6135:Rp1l1 UTSW 14 64,030,096 (GRCm38) missense probably damaging 1.00
R6428:Rp1l1 UTSW 14 64,032,389 (GRCm38) missense possibly damaging 0.92
R6594:Rp1l1 UTSW 14 64,031,677 (GRCm38) nonsense probably null
R6736:Rp1l1 UTSW 14 64,029,724 (GRCm38) missense possibly damaging 0.93
R6800:Rp1l1 UTSW 14 64,031,150 (GRCm38) missense possibly damaging 0.92
R6848:Rp1l1 UTSW 14 64,028,218 (GRCm38) missense possibly damaging 0.79
R6878:Rp1l1 UTSW 14 64,031,852 (GRCm38) missense probably benign 0.00
R6922:Rp1l1 UTSW 14 64,030,385 (GRCm38) missense possibly damaging 0.93
R6980:Rp1l1 UTSW 14 64,028,720 (GRCm38) missense probably benign 0.02
R7053:Rp1l1 UTSW 14 64,031,509 (GRCm38) missense possibly damaging 0.68
R7151:Rp1l1 UTSW 14 64,029,026 (GRCm38) missense possibly damaging 0.73
R7291:Rp1l1 UTSW 14 64,032,298 (GRCm38) missense probably benign 0.10
R7335:Rp1l1 UTSW 14 64,031,998 (GRCm38) missense probably benign 0.00
R7344:Rp1l1 UTSW 14 64,029,620 (GRCm38) missense probably benign 0.00
R7470:Rp1l1 UTSW 14 64,028,566 (GRCm38) missense probably benign
R7570:Rp1l1 UTSW 14 64,031,574 (GRCm38) nonsense probably null
R7585:Rp1l1 UTSW 14 64,030,139 (GRCm38) missense probably damaging 0.96
R7591:Rp1l1 UTSW 14 64,026,109 (GRCm38) missense probably damaging 1.00
R7667:Rp1l1 UTSW 14 64,029,803 (GRCm38) missense probably benign 0.04
R7862:Rp1l1 UTSW 14 64,028,027 (GRCm38) missense probably damaging 1.00
R7935:Rp1l1 UTSW 14 64,031,225 (GRCm38) missense probably damaging 0.99
R8256:Rp1l1 UTSW 14 64,028,153 (GRCm38) missense probably benign 0.18
R8403:Rp1l1 UTSW 14 64,028,809 (GRCm38) missense probably benign 0.21
R8709:Rp1l1 UTSW 14 64,031,846 (GRCm38) missense probably damaging 0.98
R8817:Rp1l1 UTSW 14 64,030,636 (GRCm38) missense probably benign
R8971:Rp1l1 UTSW 14 64,021,996 (GRCm38) missense probably damaging 1.00
R9380:Rp1l1 UTSW 14 64,029,026 (GRCm38) missense probably benign 0.29
R9438:Rp1l1 UTSW 14 64,028,125 (GRCm38) missense possibly damaging 0.90
R9501:Rp1l1 UTSW 14 64,028,590 (GRCm38) missense probably benign 0.00
R9652:Rp1l1 UTSW 14 64,032,265 (GRCm38) missense probably damaging 1.00
R9683:Rp1l1 UTSW 14 64,031,677 (GRCm38) missense probably damaging 0.97
X0057:Rp1l1 UTSW 14 64,030,040 (GRCm38) missense probably benign 0.14
X0063:Rp1l1 UTSW 14 64,029,223 (GRCm38) missense probably damaging 0.98
Z1088:Rp1l1 UTSW 14 64,030,378 (GRCm38) missense probably benign 0.01
Z1088:Rp1l1 UTSW 14 64,028,758 (GRCm38) missense possibly damaging 0.80
Z1176:Rp1l1 UTSW 14 64,029,144 (GRCm38) missense probably damaging 1.00
Z1177:Rp1l1 UTSW 14 64,032,297 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCCCTACATAGCCGGATGGAAC -3'
(R):5'- GCTTCATGCCCACCTTGGAAAAC -3'

Sequencing Primer
(F):5'- GATCTGTGAGTTACCATCTGAGCC -3'
(R):5'- CTTGGAAAACCTGTGCCTG -3'
Posted On 2013-06-12