Incidental Mutation 'R0538:Kcnh3'
ID49634
Institutional Source Beutler Lab
Gene Symbol Kcnh3
Ensembl Gene ENSMUSG00000037579
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 3
SynonymsElk2, Melk2, C030044P22Rik, ether a go-go like
MMRRC Submission 038730-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0538 (G1)
Quality Score224
Status Validated
Chromosome15
Chromosomal Location99224861-99242817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99240958 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 858 (G858D)
Ref Sequence ENSEMBL: ENSMUSP00000040548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041190] [ENSMUST00000041415] [ENSMUST00000163506]
Predicted Effect probably benign
Transcript: ENSMUST00000041190
SMART Domains Protein: ENSMUSP00000043901
Gene: ENSMUSG00000037570

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 81 113 N/A INTRINSIC
Pfam:MCRS_N 134 331 5.7e-98 PFAM
FHA 362 419 2.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041415
AA Change: G858D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000040548
Gene: ENSMUSG00000037579
AA Change: G858D

DomainStartEndE-ValueType
PAS 20 88 3.94e0 SMART
PAC 94 136 9.92e-6 SMART
low complexity region 148 159 N/A INTRINSIC
Pfam:Ion_trans 224 523 3.8e-34 PFAM
Pfam:Ion_trans_2 453 517 1e-12 PFAM
cNMP 593 708 2.04e-16 SMART
low complexity region 781 800 N/A INTRINSIC
low complexity region 857 872 N/A INTRINSIC
coiled coil region 886 918 N/A INTRINSIC
low complexity region 977 993 N/A INTRINSIC
low complexity region 1022 1035 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163506
SMART Domains Protein: ENSMUSP00000131407
Gene: ENSMUSG00000037570

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 68 100 N/A INTRINSIC
Pfam:MCRS_N 121 318 2.4e-97 PFAM
FHA 349 406 2.04e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229143
Predicted Effect probably benign
Transcript: ENSMUST00000229399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230973
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
MGI Phenotype FUNCTION: The protein encoded by this gene is a voltage-gated potassium channel alpha subunit predominantly expressed in the forebrain. An increase in cognitive function was observed when this gene was knocked out, while deletion of the gene resulted in hippocampal hyperexcitability and epilepsy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal long term object recognition memory, spatial reference memory, spatial working memory, and long term potentiation. Mice homozygous for a different knock-out allele exhibit neuron hyperexcitability and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 66,938,374 H6L unknown Het
Abca13 G A 11: 9,267,622 probably null Het
Acad12 C T 5: 121,607,448 R260Q possibly damaging Het
Actn1 G A 12: 80,260,100 probably benign Het
Acvrl1 A G 15: 101,136,149 T182A probably damaging Het
Adam23 T C 1: 63,567,844 probably benign Het
Adamtsl1 A T 4: 86,343,121 T1190S probably benign Het
Adh6b A T 3: 138,357,650 Y330F probably benign Het
Ak7 A G 12: 105,766,617 E540G probably damaging Het
Akr1c19 T A 13: 4,237,100 L106Q probably damaging Het
Ankrd12 A T 17: 66,049,852 S57T probably damaging Het
Aoc3 G A 11: 101,332,138 R400Q possibly damaging Het
Arel1 A T 12: 84,941,837 I46N probably damaging Het
Armc5 A G 7: 128,244,291 D752G probably damaging Het
Atp11b T C 3: 35,837,014 V812A probably damaging Het
Axin1 A G 17: 26,184,241 H131R possibly damaging Het
Bpifb3 A G 2: 153,923,869 E184G probably benign Het
Cacna2d2 T C 9: 107,524,383 probably benign Het
Catsperd T C 17: 56,662,828 F641L probably benign Het
Ccdc83 A C 7: 90,228,383 L284V probably damaging Het
Ccnt2 T A 1: 127,803,165 V593E probably damaging Het
Cd53 T A 3: 106,762,128 I185F probably benign Het
Cep350 A T 1: 155,848,620 D3077E possibly damaging Het
Ces1h C A 8: 93,357,000 probably null Het
Chrna3 T A 9: 55,016,006 T173S probably benign Het
Clca4b T C 3: 144,921,956 D418G probably benign Het
Col11a2 T C 17: 34,051,328 probably benign Het
Coq2 T A 5: 100,668,023 I97F possibly damaging Het
Cr2 A G 1: 195,160,359 probably benign Het
Ctgf T A 10: 24,596,466 C136S probably damaging Het
D2hgdh A G 1: 93,826,377 Y24C probably damaging Het
D630045J12Rik G A 6: 38,191,693 R974C probably damaging Het
Dach1 A G 14: 97,903,279 V429A possibly damaging Het
Ddr1 G A 17: 35,685,007 T660I probably damaging Het
Dlg1 A C 16: 31,796,864 probably null Het
Dmbt1 T C 7: 131,049,901 probably benign Het
Dmxl2 A T 9: 54,393,836 D2330E probably benign Het
Doc2a A G 7: 126,848,811 T5A probably benign Het
Dock2 G A 11: 34,704,718 probably benign Het
Dok4 T A 8: 94,865,238 Y290F probably damaging Het
Dopey1 A G 9: 86,485,497 D11G probably damaging Het
E230025N22Rik T C 18: 36,688,934 H235R probably benign Het
Ear6 A G 14: 51,854,452 D152G probably damaging Het
Ecscr T A 18: 35,713,636 probably benign Het
Eml6 A T 11: 29,760,010 probably benign Het
Epha4 T A 1: 77,388,541 Q607L probably damaging Het
Exoc4 A G 6: 33,972,063 N947S probably benign Het
Flg A G 3: 93,279,460 E73G probably damaging Het
Fndc1 C T 17: 7,784,341 probably benign Het
Gad1-ps T C 10: 99,444,992 noncoding transcript Het
Gata6 A G 18: 11,064,771 T528A probably benign Het
Gjd4 T C 18: 9,280,244 E278G probably benign Het
Gm13101 T A 4: 143,965,083 T357S possibly damaging Het
Gm20091 T A 10: 96,409,002 noncoding transcript Het
Gnb3 G A 6: 124,835,696 Q266* probably null Het
Grm3 A G 5: 9,512,446 V468A possibly damaging Het
Igf1r C T 7: 68,207,826 R1085C probably damaging Het
Igsf10 T C 3: 59,320,106 T2049A probably damaging Het
Jak3 A T 8: 71,685,482 D859V probably benign Het
Kcnb2 G T 1: 15,712,884 probably benign Het
Kif1a C A 1: 93,043,638 R1006L probably damaging Het
Klhl23 C T 2: 69,824,413 A209V probably benign Het
Mapk13 T C 17: 28,775,255 Y104H probably damaging Het
Mbd4 A G 6: 115,849,482 S183P probably damaging Het
Mga T C 2: 119,919,706 probably null Het
Mipol1 G A 12: 57,414,411 probably null Het
Mmp14 A G 14: 54,438,709 T299A possibly damaging Het
Mmrn1 A G 6: 60,976,469 E578G probably benign Het
Mov10l1 G A 15: 88,994,860 C193Y possibly damaging Het
Mppe1 A G 18: 67,237,477 C50R probably damaging Het
Msantd1 C A 5: 34,917,725 R44S probably damaging Het
Myt1l T C 12: 29,842,571 V69A possibly damaging Het
Nav1 A T 1: 135,464,692 probably benign Het
Ncan A G 8: 70,108,602 S572P possibly damaging Het
Nck2 T C 1: 43,569,144 probably benign Het
Nemf A T 12: 69,356,314 D31E probably damaging Het
Nlrp12 T C 7: 3,249,262 D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 probably null Het
Nup98 T C 7: 102,186,685 T184A probably damaging Het
Olfr1415 A T 1: 92,491,333 C141S possibly damaging Het
Olfr46 A T 7: 140,610,384 N73Y probably damaging Het
Olfr522 A T 7: 140,162,231 S240T probably damaging Het
Oog2 C A 4: 144,196,084 Y306* probably null Het
Osmr A G 15: 6,841,938 probably benign Het
P2rx6 A G 16: 17,568,298 N275S probably benign Het
Papd4 A T 13: 93,175,615 probably benign Het
Pbxip1 G T 3: 89,447,619 G482W possibly damaging Het
Pcsk4 T G 10: 80,325,334 I249L probably damaging Het
Pou4f2 C T 8: 78,435,662 G104E probably damaging Het
Prkdc G T 16: 15,833,788 R3763L probably damaging Het
Ptpre A T 7: 135,663,315 I207F probably damaging Het
Rapgef3 A T 15: 97,757,817 probably benign Het
Rasgrp1 T G 2: 117,284,947 K685T probably benign Het
Rnf148 C T 6: 23,654,238 R253Q probably damaging Het
Rock1 T C 18: 10,132,227 I241V possibly damaging Het
Rp1l1 T G 14: 64,022,092 V61G probably damaging Het
Scin A C 12: 40,081,771 S255A probably damaging Het
Scn8a A T 15: 101,035,624 K1570* probably null Het
Sec14l4 A C 11: 4,040,018 M106L probably benign Het
Sec63 G A 10: 42,798,799 R226H probably benign Het
Sept2 T A 1: 93,501,623 N271K probably damaging Het
Serac1 G T 17: 6,048,826 probably benign Het
Shc2 T A 10: 79,630,140 probably benign Het
Sipa1l1 T A 12: 82,425,099 D1284E probably benign Het
Slc11a2 A G 15: 100,408,216 L105P probably damaging Het
Slc1a3 T A 15: 8,650,922 T151S probably benign Het
Smarca2 G T 19: 26,691,362 K920N probably damaging Het
Sugp2 G A 8: 70,258,948 E964K probably damaging Het
Tas2r122 A C 6: 132,711,815 N38K probably benign Het
Tecpr1 G A 5: 144,206,274 R730C probably damaging Het
Themis3 G T 17: 66,593,270 N34K possibly damaging Het
Traf3ip1 A G 1: 91,499,619 T104A unknown Het
Trappc11 A G 8: 47,503,412 V843A probably benign Het
Trmt61a T A 12: 111,678,927 L99Q probably damaging Het
Trp53tg5 T A 2: 164,471,481 K91N probably damaging Het
Ufsp2 T C 8: 45,992,150 S339P probably damaging Het
Usp20 T A 2: 31,004,450 V126E probably damaging Het
Vmn1r75 T A 7: 11,880,870 N176K probably damaging Het
Vmn2r24 A G 6: 123,816,053 S780G probably benign Het
Vmn2r89 A G 14: 51,457,591 probably null Het
Vps13d A T 4: 145,045,095 S4038T probably damaging Het
Vwa7 A G 17: 35,022,651 T421A probably damaging Het
Wdr78 T C 4: 103,096,618 N128S possibly damaging Het
Wdr95 C A 5: 149,580,806 L332I probably damaging Het
Wrn T A 8: 33,336,091 K181I probably damaging Het
Zc3h6 T A 2: 129,017,223 I1058N possibly damaging Het
Zfp423 T A 8: 87,782,085 I544F probably damaging Het
Zfp446 T A 7: 12,979,589 S161T possibly damaging Het
Zmym6 T A 4: 127,123,369 M889K probably benign Het
Other mutations in Kcnh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Kcnh3 APN 15 99242473 missense possibly damaging 0.85
IGL00911:Kcnh3 APN 15 99233001 nonsense probably null
IGL01099:Kcnh3 APN 15 99239736 missense probably benign 0.02
IGL01350:Kcnh3 APN 15 99241992 missense probably benign
IGL01375:Kcnh3 APN 15 99226993 nonsense probably null
IGL01611:Kcnh3 APN 15 99229502 missense probably benign 0.04
IGL01920:Kcnh3 APN 15 99233377 missense probably benign 0.16
IGL02282:Kcnh3 APN 15 99228043 critical splice donor site probably null
IGL02581:Kcnh3 APN 15 99238171 missense possibly damaging 0.72
IGL02889:Kcnh3 APN 15 99227110 missense probably null 0.82
R0427:Kcnh3 UTSW 15 99233299 missense probably benign 0.22
R0532:Kcnh3 UTSW 15 99232963 missense probably damaging 1.00
R0552:Kcnh3 UTSW 15 99229456 missense probably damaging 1.00
R1235:Kcnh3 UTSW 15 99242103 unclassified probably null
R1290:Kcnh3 UTSW 15 99227120 splice site probably null
R1499:Kcnh3 UTSW 15 99239915 missense probably benign 0.00
R1517:Kcnh3 UTSW 15 99238209 missense probably damaging 1.00
R1706:Kcnh3 UTSW 15 99238078 missense possibly damaging 0.86
R1973:Kcnh3 UTSW 15 99229400 missense probably damaging 1.00
R2285:Kcnh3 UTSW 15 99241992 missense probably benign
R3196:Kcnh3 UTSW 15 99233981 missense probably damaging 1.00
R3716:Kcnh3 UTSW 15 99232765 missense possibly damaging 0.52
R4619:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4620:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4624:Kcnh3 UTSW 15 99226372 missense probably damaging 1.00
R4701:Kcnh3 UTSW 15 99241945 missense probably benign
R4853:Kcnh3 UTSW 15 99242089 missense possibly damaging 0.56
R4869:Kcnh3 UTSW 15 99242032 missense probably benign 0.06
R4991:Kcnh3 UTSW 15 99232756 missense probably benign 0.00
R5004:Kcnh3 UTSW 15 99226502 nonsense probably null
R5296:Kcnh3 UTSW 15 99241939 missense probably null 0.92
R5317:Kcnh3 UTSW 15 99227941 missense probably benign
R5338:Kcnh3 UTSW 15 99242394 nonsense probably null
R5658:Kcnh3 UTSW 15 99242076 missense possibly damaging 0.77
R5794:Kcnh3 UTSW 15 99232974 missense probably benign 0.01
R5934:Kcnh3 UTSW 15 99226533 missense possibly damaging 0.46
R6303:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6304:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6385:Kcnh3 UTSW 15 99227941 missense probably benign
R6466:Kcnh3 UTSW 15 99238243 missense probably damaging 1.00
R6640:Kcnh3 UTSW 15 99241768 missense probably benign 0.08
R6879:Kcnh3 UTSW 15 99238167 missense probably damaging 1.00
R6984:Kcnh3 UTSW 15 99228552 missense probably benign 0.00
X0028:Kcnh3 UTSW 15 99242100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTGGAATGTCCCATCCTGACAC -3'
(R):5'- AGCACCAGGTTCAACTCAGTCTTTC -3'

Sequencing Primer
(F):5'- TTGAAGATGGCTGCAGCT -3'
(R):5'- cattctcatttaacacgcacaac -3'
Posted On2013-06-12