Incidental Mutation 'R0538:Fndc1'
Institutional Source Beutler Lab
Gene Symbol Fndc1
Ensembl Gene ENSMUSG00000071984
Gene Namefibronectin type III domain containing 1
MMRRC Submission 038730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0538 (G1)
Quality Score126
Status Validated
Chromosomal Location7738569-7827302 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 7784341 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097425] [ENSMUST00000167580]
Predicted Effect probably benign
Transcript: ENSMUST00000097425
SMART Domains Protein: ENSMUSP00000095036
Gene: ENSMUSG00000071984

Blast:FN3 1 50 6e-25 BLAST
FN3 54 137 7.82e-4 SMART
FN3 156 240 1.48e-4 SMART
FN3 256 340 3.67e-9 SMART
low complexity region 377 388 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 646 676 N/A INTRINSIC
low complexity region 766 777 N/A INTRINSIC
low complexity region 868 884 N/A INTRINSIC
low complexity region 1021 1027 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
Blast:FN3 1227 1276 2e-18 BLAST
low complexity region 1277 1354 N/A INTRINSIC
low complexity region 1395 1403 N/A INTRINSIC
low complexity region 1407 1423 N/A INTRINSIC
FN3 1494 1577 4.32e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167580
SMART Domains Protein: ENSMUSP00000130996
Gene: ENSMUSG00000071984

signal peptide 1 29 N/A INTRINSIC
FN3 38 121 7.82e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 66,938,374 H6L unknown Het
Abca13 G A 11: 9,267,622 probably null Het
Acad12 C T 5: 121,607,448 R260Q possibly damaging Het
Actn1 G A 12: 80,260,100 probably benign Het
Acvrl1 A G 15: 101,136,149 T182A probably damaging Het
Adam23 T C 1: 63,567,844 probably benign Het
Adamtsl1 A T 4: 86,343,121 T1190S probably benign Het
Adh6b A T 3: 138,357,650 Y330F probably benign Het
Ak7 A G 12: 105,766,617 E540G probably damaging Het
Akr1c19 T A 13: 4,237,100 L106Q probably damaging Het
Ankrd12 A T 17: 66,049,852 S57T probably damaging Het
Aoc3 G A 11: 101,332,138 R400Q possibly damaging Het
Arel1 A T 12: 84,941,837 I46N probably damaging Het
Armc5 A G 7: 128,244,291 D752G probably damaging Het
Atp11b T C 3: 35,837,014 V812A probably damaging Het
Axin1 A G 17: 26,184,241 H131R possibly damaging Het
Bpifb3 A G 2: 153,923,869 E184G probably benign Het
Cacna2d2 T C 9: 107,524,383 probably benign Het
Catsperd T C 17: 56,662,828 F641L probably benign Het
Ccdc83 A C 7: 90,228,383 L284V probably damaging Het
Ccnt2 T A 1: 127,803,165 V593E probably damaging Het
Cd53 T A 3: 106,762,128 I185F probably benign Het
Cep350 A T 1: 155,848,620 D3077E possibly damaging Het
Ces1h C A 8: 93,357,000 probably null Het
Chrna3 T A 9: 55,016,006 T173S probably benign Het
Clca4b T C 3: 144,921,956 D418G probably benign Het
Col11a2 T C 17: 34,051,328 probably benign Het
Coq2 T A 5: 100,668,023 I97F possibly damaging Het
Cr2 A G 1: 195,160,359 probably benign Het
Ctgf T A 10: 24,596,466 C136S probably damaging Het
D2hgdh A G 1: 93,826,377 Y24C probably damaging Het
D630045J12Rik G A 6: 38,191,693 R974C probably damaging Het
Dach1 A G 14: 97,903,279 V429A possibly damaging Het
Ddr1 G A 17: 35,685,007 T660I probably damaging Het
Dlg1 A C 16: 31,796,864 probably null Het
Dmbt1 T C 7: 131,049,901 probably benign Het
Dmxl2 A T 9: 54,393,836 D2330E probably benign Het
Doc2a A G 7: 126,848,811 T5A probably benign Het
Dock2 G A 11: 34,704,718 probably benign Het
Dok4 T A 8: 94,865,238 Y290F probably damaging Het
Dopey1 A G 9: 86,485,497 D11G probably damaging Het
E230025N22Rik T C 18: 36,688,934 H235R probably benign Het
Ear6 A G 14: 51,854,452 D152G probably damaging Het
Ecscr T A 18: 35,713,636 probably benign Het
Eml6 A T 11: 29,760,010 probably benign Het
Epha4 T A 1: 77,388,541 Q607L probably damaging Het
Exoc4 A G 6: 33,972,063 N947S probably benign Het
Flg A G 3: 93,279,460 E73G probably damaging Het
Gad1-ps T C 10: 99,444,992 noncoding transcript Het
Gata6 A G 18: 11,064,771 T528A probably benign Het
Gjd4 T C 18: 9,280,244 E278G probably benign Het
Gm13101 T A 4: 143,965,083 T357S possibly damaging Het
Gm20091 T A 10: 96,409,002 noncoding transcript Het
Gnb3 G A 6: 124,835,696 Q266* probably null Het
Grm3 A G 5: 9,512,446 V468A possibly damaging Het
Igf1r C T 7: 68,207,826 R1085C probably damaging Het
Igsf10 T C 3: 59,320,106 T2049A probably damaging Het
Jak3 A T 8: 71,685,482 D859V probably benign Het
Kcnb2 G T 1: 15,712,884 probably benign Het
Kcnh3 G A 15: 99,240,958 G858D probably benign Het
Kif1a C A 1: 93,043,638 R1006L probably damaging Het
Klhl23 C T 2: 69,824,413 A209V probably benign Het
Mapk13 T C 17: 28,775,255 Y104H probably damaging Het
Mbd4 A G 6: 115,849,482 S183P probably damaging Het
Mga T C 2: 119,919,706 probably null Het
Mipol1 G A 12: 57,414,411 probably null Het
Mmp14 A G 14: 54,438,709 T299A possibly damaging Het
Mmrn1 A G 6: 60,976,469 E578G probably benign Het
Mov10l1 G A 15: 88,994,860 C193Y possibly damaging Het
Mppe1 A G 18: 67,237,477 C50R probably damaging Het
Msantd1 C A 5: 34,917,725 R44S probably damaging Het
Myt1l T C 12: 29,842,571 V69A possibly damaging Het
Nav1 A T 1: 135,464,692 probably benign Het
Ncan A G 8: 70,108,602 S572P possibly damaging Het
Nck2 T C 1: 43,569,144 probably benign Het
Nemf A T 12: 69,356,314 D31E probably damaging Het
Nlrp12 T C 7: 3,249,262 D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 probably null Het
Nup98 T C 7: 102,186,685 T184A probably damaging Het
Olfr1415 A T 1: 92,491,333 C141S possibly damaging Het
Olfr46 A T 7: 140,610,384 N73Y probably damaging Het
Olfr522 A T 7: 140,162,231 S240T probably damaging Het
Oog2 C A 4: 144,196,084 Y306* probably null Het
Osmr A G 15: 6,841,938 probably benign Het
P2rx6 A G 16: 17,568,298 N275S probably benign Het
Papd4 A T 13: 93,175,615 probably benign Het
Pbxip1 G T 3: 89,447,619 G482W possibly damaging Het
Pcsk4 T G 10: 80,325,334 I249L probably damaging Het
Pou4f2 C T 8: 78,435,662 G104E probably damaging Het
Prkdc G T 16: 15,833,788 R3763L probably damaging Het
Ptpre A T 7: 135,663,315 I207F probably damaging Het
Rapgef3 A T 15: 97,757,817 probably benign Het
Rasgrp1 T G 2: 117,284,947 K685T probably benign Het
Rnf148 C T 6: 23,654,238 R253Q probably damaging Het
Rock1 T C 18: 10,132,227 I241V possibly damaging Het
Rp1l1 T G 14: 64,022,092 V61G probably damaging Het
Scin A C 12: 40,081,771 S255A probably damaging Het
Scn8a A T 15: 101,035,624 K1570* probably null Het
Sec14l4 A C 11: 4,040,018 M106L probably benign Het
Sec63 G A 10: 42,798,799 R226H probably benign Het
Sept2 T A 1: 93,501,623 N271K probably damaging Het
Serac1 G T 17: 6,048,826 probably benign Het
Shc2 T A 10: 79,630,140 probably benign Het
Sipa1l1 T A 12: 82,425,099 D1284E probably benign Het
Slc11a2 A G 15: 100,408,216 L105P probably damaging Het
Slc1a3 T A 15: 8,650,922 T151S probably benign Het
Smarca2 G T 19: 26,691,362 K920N probably damaging Het
Sugp2 G A 8: 70,258,948 E964K probably damaging Het
Tas2r122 A C 6: 132,711,815 N38K probably benign Het
Tecpr1 G A 5: 144,206,274 R730C probably damaging Het
Themis3 G T 17: 66,593,270 N34K possibly damaging Het
Traf3ip1 A G 1: 91,499,619 T104A unknown Het
Trappc11 A G 8: 47,503,412 V843A probably benign Het
Trmt61a T A 12: 111,678,927 L99Q probably damaging Het
Trp53tg5 T A 2: 164,471,481 K91N probably damaging Het
Ufsp2 T C 8: 45,992,150 S339P probably damaging Het
Usp20 T A 2: 31,004,450 V126E probably damaging Het
Vmn1r75 T A 7: 11,880,870 N176K probably damaging Het
Vmn2r24 A G 6: 123,816,053 S780G probably benign Het
Vmn2r89 A G 14: 51,457,591 probably null Het
Vps13d A T 4: 145,045,095 S4038T probably damaging Het
Vwa7 A G 17: 35,022,651 T421A probably damaging Het
Wdr78 T C 4: 103,096,618 N128S possibly damaging Het
Wdr95 C A 5: 149,580,806 L332I probably damaging Het
Wrn T A 8: 33,336,091 K181I probably damaging Het
Zc3h6 T A 2: 129,017,223 I1058N possibly damaging Het
Zfp423 T A 8: 87,782,085 I544F probably damaging Het
Zfp446 T A 7: 12,979,589 S161T possibly damaging Het
Zmym6 T A 4: 127,123,369 M889K probably benign Het
Other mutations in Fndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Fndc1 APN 17 7765254 missense unknown
IGL00590:Fndc1 APN 17 7765101 missense unknown
IGL00765:Fndc1 APN 17 7772693 missense unknown
IGL00904:Fndc1 APN 17 7756363 missense probably benign 0.35
IGL01153:Fndc1 APN 17 7780042 critical splice donor site probably null
IGL01557:Fndc1 APN 17 7756389 missense probably damaging 0.99
IGL02493:Fndc1 APN 17 7775545 missense unknown
IGL02501:Fndc1 APN 17 7765398 missense unknown
IGL02503:Fndc1 APN 17 7771516 missense unknown
IGL02887:Fndc1 APN 17 7773638 missense unknown
IGL03348:Fndc1 APN 17 7772647 missense unknown
pinnacle UTSW 17 7773322 missense unknown
spire UTSW 17 7771480 missense unknown
IGL02988:Fndc1 UTSW 17 7753523 missense possibly damaging 0.95
PIT4466001:Fndc1 UTSW 17 7750374 missense probably damaging 1.00
R0336:Fndc1 UTSW 17 7765107 missense unknown
R0403:Fndc1 UTSW 17 7753723 missense probably damaging 1.00
R0403:Fndc1 UTSW 17 7775588 splice site probably null
R0646:Fndc1 UTSW 17 7741673 missense possibly damaging 0.92
R1140:Fndc1 UTSW 17 7775426 missense unknown
R1523:Fndc1 UTSW 17 7773209 missense unknown
R1609:Fndc1 UTSW 17 7772766 missense unknown
R1632:Fndc1 UTSW 17 7773200 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R1888:Fndc1 UTSW 17 7771789 missense unknown
R2004:Fndc1 UTSW 17 7804929 missense probably damaging 1.00
R2007:Fndc1 UTSW 17 7778748 unclassified probably benign
R2128:Fndc1 UTSW 17 7778665 unclassified probably benign
R2187:Fndc1 UTSW 17 7741772 missense probably damaging 1.00
R2251:Fndc1 UTSW 17 7753607 missense probably damaging 1.00
R2322:Fndc1 UTSW 17 7789015 missense probably damaging 0.98
R2425:Fndc1 UTSW 17 7805018 missense probably damaging 1.00
R2921:Fndc1 UTSW 17 7804875 missense probably damaging 0.98
R2985:Fndc1 UTSW 17 7756323 missense possibly damaging 0.93
R3436:Fndc1 UTSW 17 7750357 missense probably damaging 0.99
R3499:Fndc1 UTSW 17 7753584 missense possibly damaging 0.70
R3508:Fndc1 UTSW 17 7765108 nonsense probably null
R3766:Fndc1 UTSW 17 7784421 missense probably damaging 1.00
R3813:Fndc1 UTSW 17 7773322 missense unknown
R3814:Fndc1 UTSW 17 7773322 missense unknown
R4031:Fndc1 UTSW 17 7769752 nonsense probably null
R4544:Fndc1 UTSW 17 7773544 missense unknown
R4583:Fndc1 UTSW 17 7739249 missense probably damaging 1.00
R4619:Fndc1 UTSW 17 7765204 missense unknown
R4700:Fndc1 UTSW 17 7771480 missense unknown
R4743:Fndc1 UTSW 17 7772279 nonsense probably null
R4803:Fndc1 UTSW 17 7753706 missense probably damaging 0.98
R4862:Fndc1 UTSW 17 7769735 missense unknown
R4876:Fndc1 UTSW 17 7771639 missense unknown
R5057:Fndc1 UTSW 17 7771970 nonsense probably null
R5327:Fndc1 UTSW 17 7772708 missense unknown
R5372:Fndc1 UTSW 17 7765210 missense unknown
R5533:Fndc1 UTSW 17 7772776 missense unknown
R5754:Fndc1 UTSW 17 7769753 missense unknown
R5762:Fndc1 UTSW 17 7771534 missense unknown
R5830:Fndc1 UTSW 17 7789086 missense possibly damaging 0.87
R5924:Fndc1 UTSW 17 7773610 missense unknown
R6147:Fndc1 UTSW 17 7753762 splice site probably null
R6175:Fndc1 UTSW 17 7772647 missense unknown
R6303:Fndc1 UTSW 17 7758485 missense probably damaging 0.98
R6377:Fndc1 UTSW 17 7769735 missense unknown
R6704:Fndc1 UTSW 17 7771810 missense unknown
R6857:Fndc1 UTSW 17 7772170 missense unknown
R6865:Fndc1 UTSW 17 7772840 missense unknown
R7069:Fndc1 UTSW 17 7769735 missense unknown
R7153:Fndc1 UTSW 17 7801645 missense probably damaging 1.00
R7159:Fndc1 UTSW 17 7800931 missense probably damaging 0.97
R7359:Fndc1 UTSW 17 7813486 splice site probably null
R7731:Fndc1 UTSW 17 7773439 missense unknown
R7743:Fndc1 UTSW 17 7765137 missense unknown
R7884:Fndc1 UTSW 17 7773197 missense unknown
R8071:Fndc1 UTSW 17 7772530 missense unknown
R8100:Fndc1 UTSW 17 7771853 missense unknown
R8317:Fndc1 UTSW 17 7800888 nonsense probably null
R8362:Fndc1 UTSW 17 7782375 missense unknown
Z1088:Fndc1 UTSW 17 7782479 missense probably damaging 0.96
Z1176:Fndc1 UTSW 17 7773593 nonsense probably null
Z1176:Fndc1 UTSW 17 7804877 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgaaacaagaacagtgatagggg -3'
Posted On2013-06-12