Incidental Mutation 'R0538:Ddr1'
ID 49647
Institutional Source Beutler Lab
Gene Symbol Ddr1
Ensembl Gene ENSMUSG00000003534
Gene Name discoidin domain receptor family, member 1
Synonyms CD167a, Cak
MMRRC Submission 038730-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.939) question?
Stock # R0538 (G1)
Quality Score 215
Status Not validated
Chromosome 17
Chromosomal Location 35992459-36015513 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35995899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 660 (T660I)
Ref Sequence ENSEMBL: ENSMUSP00000133047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003628] [ENSMUST00000097333] [ENSMUST00000117301] [ENSMUST00000119825] [ENSMUST00000155628] [ENSMUST00000155957] [ENSMUST00000166980]
AlphaFold Q03146
Predicted Effect probably damaging
Transcript: ENSMUST00000003628
AA Change: T660I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003628
Gene: ENSMUSG00000003534
AA Change: T660I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097333
AA Change: T623I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094945
Gene: ENSMUSG00000003534
AA Change: T623I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
TyrKc 571 866 8.14e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117301
AA Change: T660I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112570
Gene: ENSMUSG00000003534
AA Change: T660I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 4e-131 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119825
AA Change: T660I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113062
Gene: ENSMUSG00000003534
AA Change: T660I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155628
SMART Domains Protein: ENSMUSP00000133659
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 218 236 N/A INTRINSIC
Blast:FA58C 239 319 1e-45 BLAST
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
PDB:4CKR|A 562 584 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000155957
SMART Domains Protein: ENSMUSP00000117427
Gene: ENSMUSG00000003534

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 2.75e-34 SMART
low complexity region 192 209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166980
AA Change: T660I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133047
Gene: ENSMUSG00000003534
AA Change: T660I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FA58C 31 186 1.3e-36 SMART
low complexity region 218 236 N/A INTRINSIC
low complexity region 379 390 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
low complexity region 473 492 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
low complexity region 548 565 N/A INTRINSIC
TyrKc 608 903 3.9e-131 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.7%
Validation Efficiency 98% (126/129)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Receptor tyrosine kinases play a key role in the communication of cells with their microenvironment. These kinases are involved in the regulation of cell growth, differentiation and metabolism. The protein encoded by this gene belongs to a subfamily of tyrosine kinase receptors with homology to Dictyostelium discoideum protein discoidin I in their extracellular domain, and that are activated by various types of collagen. Expression of this protein is restricted to epithelial cells, particularly in the kidney, lung, gastrointestinal tract, and brain. In addition, it has been shown to be significantly overexpressed in several human tumors. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutant mice are viable but smaller than control mice. Most mutant females are not able to give birth because developing blastocysts fail to implant. Successfully reproducing females show a lactation defect which is attributed to hyperproliferation and aberrant branching of mammary ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I07Rik A T 14: 67,175,823 (GRCm39) H6L unknown Het
Abca13 G A 11: 9,217,622 (GRCm39) probably null Het
Acad12 C T 5: 121,745,511 (GRCm39) R260Q possibly damaging Het
Actn1 G A 12: 80,306,874 (GRCm39) probably benign Het
Acvrl1 A G 15: 101,034,030 (GRCm39) T182A probably damaging Het
Adam23 T C 1: 63,607,003 (GRCm39) probably benign Het
Adamtsl1 A T 4: 86,261,358 (GRCm39) T1190S probably benign Het
Adh6b A T 3: 138,063,411 (GRCm39) Y330F probably benign Het
Ak7 A G 12: 105,732,876 (GRCm39) E540G probably damaging Het
Akr1c19 T A 13: 4,287,099 (GRCm39) L106Q probably damaging Het
Ankrd12 A T 17: 66,356,847 (GRCm39) S57T probably damaging Het
Aoc3 G A 11: 101,222,964 (GRCm39) R400Q possibly damaging Het
Arel1 A T 12: 84,988,611 (GRCm39) I46N probably damaging Het
Armc5 A G 7: 127,843,463 (GRCm39) D752G probably damaging Het
Atp11b T C 3: 35,891,163 (GRCm39) V812A probably damaging Het
Axin1 A G 17: 26,403,215 (GRCm39) H131R possibly damaging Het
Bpifb3 A G 2: 153,765,789 (GRCm39) E184G probably benign Het
Cacna2d2 T C 9: 107,401,582 (GRCm39) probably benign Het
Catsperd T C 17: 56,969,828 (GRCm39) F641L probably benign Het
Ccdc83 A C 7: 89,877,591 (GRCm39) L284V probably damaging Het
Ccn2 T A 10: 24,472,364 (GRCm39) C136S probably damaging Het
Ccnt2 T A 1: 127,730,902 (GRCm39) V593E probably damaging Het
Cd53 T A 3: 106,669,444 (GRCm39) I185F probably benign Het
Cep350 A T 1: 155,724,366 (GRCm39) D3077E possibly damaging Het
Ces1h C A 8: 94,083,628 (GRCm39) probably null Het
Chrna3 T A 9: 54,923,290 (GRCm39) T173S probably benign Het
Clca4b T C 3: 144,627,717 (GRCm39) D418G probably benign Het
Col11a2 T C 17: 34,270,302 (GRCm39) probably benign Het
Coq2 T A 5: 100,815,889 (GRCm39) I97F possibly damaging Het
Cr2 A G 1: 194,842,667 (GRCm39) probably benign Het
D2hgdh A G 1: 93,754,099 (GRCm39) Y24C probably damaging Het
D630045J12Rik G A 6: 38,168,628 (GRCm39) R974C probably damaging Het
Dach1 A G 14: 98,140,715 (GRCm39) V429A possibly damaging Het
Dlg1 A C 16: 31,615,682 (GRCm39) probably null Het
Dmbt1 T C 7: 130,651,631 (GRCm39) probably benign Het
Dmxl2 A T 9: 54,301,120 (GRCm39) D2330E probably benign Het
Dnai4 T C 4: 102,953,815 (GRCm39) N128S possibly damaging Het
Doc2a A G 7: 126,447,983 (GRCm39) T5A probably benign Het
Dock2 G A 11: 34,595,545 (GRCm39) probably benign Het
Dok4 T A 8: 95,591,866 (GRCm39) Y290F probably damaging Het
Dop1a A G 9: 86,367,550 (GRCm39) D11G probably damaging Het
E230025N22Rik T C 18: 36,821,987 (GRCm39) H235R probably benign Het
Ear6 A G 14: 52,091,909 (GRCm39) D152G probably damaging Het
Ecscr T A 18: 35,846,689 (GRCm39) probably benign Het
Eml6 A T 11: 29,710,010 (GRCm39) probably benign Het
Epha4 T A 1: 77,365,178 (GRCm39) Q607L probably damaging Het
Exoc4 A G 6: 33,948,998 (GRCm39) N947S probably benign Het
Flg A G 3: 93,186,767 (GRCm39) E73G probably damaging Het
Fndc1 C T 17: 8,003,173 (GRCm39) probably benign Het
Gad1-ps T C 10: 99,280,854 (GRCm39) noncoding transcript Het
Gata6 A G 18: 11,064,771 (GRCm39) T528A probably benign Het
Gjd4 T C 18: 9,280,244 (GRCm39) E278G probably benign Het
Gm20091 T A 10: 96,244,864 (GRCm39) noncoding transcript Het
Gnb3 G A 6: 124,812,659 (GRCm39) Q266* probably null Het
Grm3 A G 5: 9,562,446 (GRCm39) V468A possibly damaging Het
Igf1r C T 7: 67,857,574 (GRCm39) R1085C probably damaging Het
Igsf10 T C 3: 59,227,527 (GRCm39) T2049A probably damaging Het
Jak3 A T 8: 72,138,126 (GRCm39) D859V probably benign Het
Kcnb2 G T 1: 15,783,108 (GRCm39) probably benign Het
Kcnh3 G A 15: 99,138,839 (GRCm39) G858D probably benign Het
Kif1a C A 1: 92,971,360 (GRCm39) R1006L probably damaging Het
Klhl23 C T 2: 69,654,757 (GRCm39) A209V probably benign Het
Mapk13 T C 17: 28,994,229 (GRCm39) Y104H probably damaging Het
Mbd4 A G 6: 115,826,443 (GRCm39) S183P probably damaging Het
Mga T C 2: 119,750,187 (GRCm39) probably null Het
Mipol1 G A 12: 57,461,197 (GRCm39) probably null Het
Mmp14 A G 14: 54,676,166 (GRCm39) T299A possibly damaging Het
Mmrn1 A G 6: 60,953,453 (GRCm39) E578G probably benign Het
Mov10l1 G A 15: 88,879,063 (GRCm39) C193Y possibly damaging Het
Mppe1 A G 18: 67,370,548 (GRCm39) C50R probably damaging Het
Msantd1 C A 5: 35,075,069 (GRCm39) R44S probably damaging Het
Myt1l T C 12: 29,892,570 (GRCm39) V69A possibly damaging Het
Nav1 A T 1: 135,392,430 (GRCm39) probably benign Het
Ncan A G 8: 70,561,252 (GRCm39) S572P possibly damaging Het
Nck2 T C 1: 43,608,304 (GRCm39) probably benign Het
Nemf A T 12: 69,403,088 (GRCm39) D31E probably damaging Het
Nlrp12 T C 7: 3,297,892 (GRCm39) D93G possibly damaging Het
Nsmaf A T 4: 6,419,930 (GRCm39) probably null Het
Nup98 T C 7: 101,835,892 (GRCm39) T184A probably damaging Het
Oog2 C A 4: 143,922,654 (GRCm39) Y306* probably null Het
Or13a18 A T 7: 140,190,297 (GRCm39) N73Y probably damaging Het
Or6ae1 A T 7: 139,742,144 (GRCm39) S240T probably damaging Het
Or6b2b A T 1: 92,419,055 (GRCm39) C141S possibly damaging Het
Osmr A G 15: 6,871,419 (GRCm39) probably benign Het
P2rx6 A G 16: 17,386,162 (GRCm39) N275S probably benign Het
Pbxip1 G T 3: 89,354,926 (GRCm39) G482W possibly damaging Het
Pcsk4 T G 10: 80,161,168 (GRCm39) I249L probably damaging Het
Pou4f2 C T 8: 79,162,291 (GRCm39) G104E probably damaging Het
Pramel28 T A 4: 143,691,653 (GRCm39) T357S possibly damaging Het
Prkdc G T 16: 15,651,652 (GRCm39) R3763L probably damaging Het
Ptpre A T 7: 135,265,044 (GRCm39) I207F probably damaging Het
Rapgef3 A T 15: 97,655,698 (GRCm39) probably benign Het
Rasgrp1 T G 2: 117,115,428 (GRCm39) K685T probably benign Het
Rnf148 C T 6: 23,654,237 (GRCm39) R253Q probably damaging Het
Rock1 T C 18: 10,132,227 (GRCm39) I241V possibly damaging Het
Rp1l1 T G 14: 64,259,541 (GRCm39) V61G probably damaging Het
Scin A C 12: 40,131,770 (GRCm39) S255A probably damaging Het
Scn8a A T 15: 100,933,505 (GRCm39) K1570* probably null Het
Sec14l4 A C 11: 3,990,018 (GRCm39) M106L probably benign Het
Sec63 G A 10: 42,674,795 (GRCm39) R226H probably benign Het
Septin2 T A 1: 93,429,345 (GRCm39) N271K probably damaging Het
Serac1 G T 17: 6,099,101 (GRCm39) probably benign Het
Shc2 T A 10: 79,465,974 (GRCm39) probably benign Het
Sipa1l1 T A 12: 82,471,873 (GRCm39) D1284E probably benign Het
Slc11a2 A G 15: 100,306,097 (GRCm39) L105P probably damaging Het
Slc1a3 T A 15: 8,680,406 (GRCm39) T151S probably benign Het
Smarca2 G T 19: 26,668,762 (GRCm39) K920N probably damaging Het
Sugp2 G A 8: 70,711,598 (GRCm39) E964K probably damaging Het
Tas2r122 A C 6: 132,688,778 (GRCm39) N38K probably benign Het
Tecpr1 G A 5: 144,143,092 (GRCm39) R730C probably damaging Het
Tent2 A T 13: 93,312,123 (GRCm39) probably benign Het
Themis3 G T 17: 66,900,265 (GRCm39) N34K possibly damaging Het
Traf3ip1 A G 1: 91,427,341 (GRCm39) T104A unknown Het
Trappc11 A G 8: 47,956,447 (GRCm39) V843A probably benign Het
Trmt61a T A 12: 111,645,361 (GRCm39) L99Q probably damaging Het
Trp53tg5 T A 2: 164,313,401 (GRCm39) K91N probably damaging Het
Ufsp2 T C 8: 46,445,187 (GRCm39) S339P probably damaging Het
Usp20 T A 2: 30,894,462 (GRCm39) V126E probably damaging Het
Vmn1r75 T A 7: 11,614,797 (GRCm39) N176K probably damaging Het
Vmn2r24 A G 6: 123,793,012 (GRCm39) S780G probably benign Het
Vmn2r89 A G 14: 51,695,048 (GRCm39) probably null Het
Vps13d A T 4: 144,771,665 (GRCm39) S4038T probably damaging Het
Vwa7 A G 17: 35,241,627 (GRCm39) T421A probably damaging Het
Wdr95 C A 5: 149,504,271 (GRCm39) L332I probably damaging Het
Wrn T A 8: 33,826,119 (GRCm39) K181I probably damaging Het
Zc3h6 T A 2: 128,859,143 (GRCm39) I1058N possibly damaging Het
Zfp423 T A 8: 88,508,713 (GRCm39) I544F probably damaging Het
Zfp446 T A 7: 12,713,516 (GRCm39) S161T possibly damaging Het
Zmym6 T A 4: 127,017,162 (GRCm39) M889K probably benign Het
Other mutations in Ddr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ddr1 APN 17 35,994,372 (GRCm39) missense probably damaging 1.00
IGL02126:Ddr1 APN 17 35,999,481 (GRCm39) missense probably damaging 0.99
IGL02167:Ddr1 APN 17 36,000,963 (GRCm39) missense possibly damaging 0.55
IGL02250:Ddr1 APN 17 35,994,372 (GRCm39) missense probably damaging 1.00
IGL02251:Ddr1 APN 17 35,994,372 (GRCm39) missense probably damaging 1.00
IGL02367:Ddr1 APN 17 35,994,372 (GRCm39) missense probably damaging 1.00
Checkpoint UTSW 17 35,994,489 (GRCm39) missense probably damaging 1.00
Mauer UTSW 17 36,000,561 (GRCm39) nonsense probably null
PIT4449001:Ddr1 UTSW 17 35,998,141 (GRCm39) missense possibly damaging 0.54
R0674:Ddr1 UTSW 17 36,000,561 (GRCm39) nonsense probably null
R4829:Ddr1 UTSW 17 35,996,005 (GRCm39) missense probably damaging 1.00
R4940:Ddr1 UTSW 17 36,001,022 (GRCm39) missense probably damaging 1.00
R5085:Ddr1 UTSW 17 35,993,667 (GRCm39) critical splice acceptor site probably null
R5112:Ddr1 UTSW 17 35,993,377 (GRCm39) missense probably benign
R5124:Ddr1 UTSW 17 35,994,489 (GRCm39) missense probably damaging 1.00
R5652:Ddr1 UTSW 17 35,997,400 (GRCm39) missense probably benign
R5653:Ddr1 UTSW 17 35,997,400 (GRCm39) missense probably benign
R5654:Ddr1 UTSW 17 35,997,400 (GRCm39) missense probably benign
R6427:Ddr1 UTSW 17 35,998,114 (GRCm39) missense probably benign
R7226:Ddr1 UTSW 17 36,002,039 (GRCm39) missense possibly damaging 0.94
R7405:Ddr1 UTSW 17 36,000,992 (GRCm39) missense probably damaging 1.00
R7534:Ddr1 UTSW 17 35,993,514 (GRCm39) critical splice donor site probably null
R7568:Ddr1 UTSW 17 35,995,174 (GRCm39) missense probably damaging 1.00
R8010:Ddr1 UTSW 17 36,002,384 (GRCm39) missense possibly damaging 0.93
R8736:Ddr1 UTSW 17 35,995,104 (GRCm39) missense probably damaging 0.96
R8889:Ddr1 UTSW 17 35,993,556 (GRCm39) missense probably benign 0.21
R8892:Ddr1 UTSW 17 35,993,556 (GRCm39) missense probably benign 0.21
R9224:Ddr1 UTSW 17 36,000,609 (GRCm39) missense probably damaging 0.96
R9457:Ddr1 UTSW 17 35,993,650 (GRCm39) missense possibly damaging 0.67
R9700:Ddr1 UTSW 17 35,993,288 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGGCTCTCCCATCTTCAAGGTTC -3'
(R):5'- GGCTGACAGCTTGCCATTTGTG -3'

Sequencing Primer
(F):5'- ccctctcctccctccaac -3'
(R):5'- AGCTTGCCATTTGTGCTGATAATC -3'
Posted On 2013-06-12