Incidental Mutation 'R0539:Mrc1'
ID49660
Institutional Source Beutler Lab
Gene Symbol Mrc1
Ensembl Gene ENSMUSG00000026712
Gene Namemannose receptor, C type 1
SynonymsCD206, MR
MMRRC Submission 038731-MU
Accession Numbers

Ncbi RefSeq: NM_008625.2; MGI:97142

Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R0539 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location14229392-14332057 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 14270126 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028045]
PDB Structure CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028045
SMART Domains Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712

DomainStartEndE-ValueType
RICIN 22 142 8.09e-18 SMART
FN2 161 209 1.83e-27 SMART
CLECT 216 341 8.87e-26 SMART
CLECT 362 487 3.51e-38 SMART
CLECT 504 626 8.2e-30 SMART
CLECT 646 778 2.34e-34 SMART
CLECT 800 923 2.17e-29 SMART
low complexity region 935 941 N/A INTRINSIC
CLECT 944 1079 3.35e-35 SMART
CLECT 1094 1212 4.11e-21 SMART
CLECT 1229 1355 3.63e-31 SMART
transmembrane domain 1388 1410 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (107/107)
MGI Phenotype Strain: 2656742; 2448258
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik T A 5: 48,379,350 H129Q probably damaging Het
Abca14 G A 7: 120,207,797 R22Q probably damaging Het
Abcg5 T A 17: 84,669,075 M445L probably benign Het
Abhd3 T A 18: 10,645,208 N357I possibly damaging Het
Adamts5 C T 16: 85,868,692 G574S probably damaging Het
Adgrg5 T A 8: 94,938,632 N389K probably damaging Het
Ankk1 A G 9: 49,418,030 V80A probably benign Het
Arhgap20 A G 9: 51,850,155 Q1066R probably benign Het
Arhgap21 T A 2: 20,914,799 K32* probably null Het
AW209491 T C 13: 14,637,732 F390S probably damaging Het
Axl A T 7: 25,778,717 probably benign Het
Bri3bp A G 5: 125,454,539 Y183C probably damaging Het
Cad T C 5: 31,075,457 probably benign Het
Capns2 A G 8: 92,901,732 Q83R possibly damaging Het
Ccdc180 G T 4: 45,922,010 R1028L probably damaging Het
Cdh19 C A 1: 110,925,162 V348F possibly damaging Het
Chrm2 T C 6: 36,523,706 V166A possibly damaging Het
Clmp A G 9: 40,782,486 Y333C probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Copz1 A G 15: 103,291,365 Y69C probably damaging Het
Crybg1 T C 10: 43,998,898 D738G probably benign Het
Ctnna2 T A 6: 76,973,899 I165F probably damaging Het
Dcaf7 T G 11: 106,051,826 S200A probably damaging Het
Deup1 T A 9: 15,582,597 R416S possibly damaging Het
Dmxl1 T A 18: 49,857,430 probably benign Het
Dnase2b A T 3: 146,589,155 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Ephb2 T C 4: 136,655,976 Y931C probably damaging Het
Fam83h T C 15: 76,003,227 S754G possibly damaging Het
Fibp T A 19: 5,463,188 V177D probably damaging Het
Gfpt2 T C 11: 49,832,898 I571T probably damaging Het
Grm7 T G 6: 111,359,094 probably benign Het
Gsdma3 A G 11: 98,635,919 Y335C probably damaging Het
H2-T23 A T 17: 36,032,141 probably benign Het
Hist1h4c A G 13: 23,698,148 F101S probably damaging Het
Hydin A G 8: 110,523,072 I2216V probably benign Het
Ipo8 A G 6: 148,818,108 M113T probably benign Het
Kdm6a A G X: 18,262,425 E1045G probably damaging Het
Kyat1 C T 2: 30,188,217 E117K probably damaging Het
Lin7b A G 7: 45,369,902 probably benign Het
Lipn G A 19: 34,084,603 probably benign Het
Lrfn2 C A 17: 49,071,044 N384K probably damaging Het
Lrrc6 A T 15: 66,447,606 V305D probably damaging Het
Map1b T C 13: 99,434,018 K732E unknown Het
Mpl A G 4: 118,443,508 M541T possibly damaging Het
Mprip T C 11: 59,741,117 probably benign Het
Ms4a13 T C 19: 11,171,871 probably benign Het
Myo18b G T 5: 112,723,868 R2116S probably damaging Het
Nav2 A G 7: 49,461,938 T731A probably damaging Het
Ncoa6 G T 2: 155,415,697 A642D probably benign Het
Ndufs7 T A 10: 80,254,831 probably benign Het
Nfkbiz G A 16: 55,817,879 T406M probably benign Het
Nr4a1 A G 15: 101,270,884 E267G probably damaging Het
Nrxn2 T G 19: 6,493,404 F1103V probably damaging Het
Olfr1028 G T 2: 85,952,009 M315I probably benign Het
Olfr1044 A T 2: 86,171,043 M258K probably damaging Het
Olfr1441 C T 19: 12,422,809 L167F probably damaging Het
Olfr381 T C 11: 73,486,063 T254A probably benign Het
Olfr479 C T 7: 108,055,822 T280I probably damaging Het
Olfr958 A T 9: 39,550,297 D191E probably damaging Het
Olfr996 T A 2: 85,579,775 C179S probably damaging Het
Phf1 A G 17: 26,934,458 probably null Het
Pip C T 6: 41,849,885 Q53* probably null Het
Ppp2ca T C 11: 52,118,162 probably null Het
Prl2c5 A G 13: 13,189,321 probably null Het
Psph T A 5: 129,766,577 probably benign Het
Ptch1 C T 13: 63,543,480 probably benign Het
Ptprs C T 17: 56,458,255 V10M probably damaging Het
Rarg T C 15: 102,238,877 R358G probably damaging Het
Rbl2 T C 8: 91,112,505 probably benign Het
Robo2 A T 16: 73,985,574 probably benign Het
Scin A T 12: 40,081,766 D256E possibly damaging Het
Scn8a T C 15: 101,016,568 Y1152H probably damaging Het
Sh2b2 T G 5: 136,225,301 probably benign Het
Slc13a2 G A 11: 78,399,138 P450L probably damaging Het
Slc2a12 A G 10: 22,692,230 I519V probably benign Het
Slc30a9 C T 5: 67,334,610 T260M probably damaging Het
Slc9a7 A T X: 20,202,762 F184Y probably damaging Het
Smc2 G T 4: 52,458,558 K466N probably benign Het
Snx16 T C 3: 10,426,218 E209G probably damaging Het
Sp3 A T 2: 72,970,532 I423N possibly damaging Het
Ssh2 G T 11: 77,454,794 V1202F probably benign Het
Stam2 A T 2: 52,703,256 probably benign Het
Stox2 T C 8: 47,194,035 Y194C probably damaging Het
Sult3a1 A G 10: 33,866,523 T49A probably damaging Het
Supt3 A T 17: 45,003,131 I136F possibly damaging Het
Syne2 A T 12: 76,024,121 R103S possibly damaging Het
Synj2 T A 17: 5,996,888 M1K probably null Het
Tas2r110 T C 6: 132,868,371 S122P possibly damaging Het
Tln1 A G 4: 43,543,434 probably null Het
Tmem117 A G 15: 94,714,912 T110A possibly damaging Het
Tmem247 A G 17: 86,917,478 D5G probably benign Het
Tmem39a T A 16: 38,590,975 F363I probably benign Het
Tmem80 G A 7: 141,335,895 A73T possibly damaging Het
Trpm4 C T 7: 45,305,472 G901S probably damaging Het
Upk3bl T C 5: 136,063,986 probably benign Het
Vmn1r120 A T 7: 21,053,472 C105S probably damaging Het
Vmn1r69 A T 7: 10,580,947 probably benign Het
Vmn2r95 T C 17: 18,452,100 F700L probably damaging Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Zbtb22 A G 17: 33,918,144 D421G possibly damaging Het
Zbtb45 G A 7: 13,006,333 R452C probably damaging Het
Zfhx3 T C 8: 108,800,509 Y1013H probably damaging Het
Zfp329 C T 7: 12,806,593 probably null Het
Zfp532 T A 18: 65,623,766 S257T probably benign Het
Zfp933 G A 4: 147,826,548 T197I probably benign Het
Zgrf1 T A 3: 127,615,192 N1649K probably damaging Het
Other mutations in Mrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Mrc1 APN 2 14328425 missense probably damaging 1.00
IGL01326:Mrc1 APN 2 14266524 missense probably damaging 1.00
IGL01340:Mrc1 APN 2 14310084 critical splice donor site probably null
IGL01758:Mrc1 APN 2 14238248 missense probably damaging 1.00
IGL01799:Mrc1 APN 2 14238376 missense probably damaging 1.00
IGL02280:Mrc1 APN 2 14244213 missense probably benign 0.19
IGL02435:Mrc1 APN 2 14248860 nonsense probably null
IGL03073:Mrc1 APN 2 14305342 missense probably damaging 1.00
IGL03110:Mrc1 APN 2 14293478 nonsense probably null
IGL03155:Mrc1 APN 2 14331101 missense probably benign 0.00
IGL03289:Mrc1 APN 2 14308823 critical splice donor site probably null
amlodipine UTSW 2 14270205 missense probably damaging 1.00
losartan UTSW 2 14294786 splice site probably null
Shug UTSW 2 14270206 missense probably damaging 1.00
sussigkeit UTSW 2 14325381 splice site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0011:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0066:Mrc1 UTSW 2 14261200 missense probably benign 0.42
R0110:Mrc1 UTSW 2 14238542 splice site probably benign
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0234:Mrc1 UTSW 2 14279894 missense possibly damaging 0.65
R0381:Mrc1 UTSW 2 14307909 missense probably benign 0.05
R0505:Mrc1 UTSW 2 14310032 missense probably damaging 1.00
R0613:Mrc1 UTSW 2 14294819 missense probably damaging 0.96
R0626:Mrc1 UTSW 2 14328571 nonsense probably null
R1122:Mrc1 UTSW 2 14261336 critical splice donor site probably null
R1281:Mrc1 UTSW 2 14293510 missense probably damaging 1.00
R1399:Mrc1 UTSW 2 14279925 missense probably damaging 1.00
R1428:Mrc1 UTSW 2 14315263 missense probably benign 0.11
R1571:Mrc1 UTSW 2 14308733 missense probably damaging 0.97
R1596:Mrc1 UTSW 2 14248890 missense possibly damaging 0.91
R1730:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1733:Mrc1 UTSW 2 14257099 missense probably damaging 1.00
R1783:Mrc1 UTSW 2 14327844 missense probably benign 0.01
R1860:Mrc1 UTSW 2 14328579 missense probably benign 0.30
R1872:Mrc1 UTSW 2 14325381 splice site probably null
R1889:Mrc1 UTSW 2 14308677 critical splice acceptor site probably null
R1938:Mrc1 UTSW 2 14319241 missense possibly damaging 0.89
R1971:Mrc1 UTSW 2 14244292 critical splice donor site probably null
R2031:Mrc1 UTSW 2 14321773 missense probably damaging 1.00
R2136:Mrc1 UTSW 2 14270189 missense probably damaging 1.00
R2152:Mrc1 UTSW 2 14327864 missense probably damaging 1.00
R2168:Mrc1 UTSW 2 14244204 missense possibly damaging 0.90
R2273:Mrc1 UTSW 2 14325372 missense probably damaging 1.00
R2901:Mrc1 UTSW 2 14328543 missense possibly damaging 0.94
R3767:Mrc1 UTSW 2 14319170 missense probably damaging 1.00
R3795:Mrc1 UTSW 2 14288982 splice site probably benign
R4028:Mrc1 UTSW 2 14238248 missense probably damaging 1.00
R4668:Mrc1 UTSW 2 14293486 missense probably damaging 1.00
R4828:Mrc1 UTSW 2 14270206 missense probably damaging 1.00
R4897:Mrc1 UTSW 2 14319141 missense probably benign 0.01
R4950:Mrc1 UTSW 2 14271280 missense probably damaging 1.00
R5000:Mrc1 UTSW 2 14244189 missense probably damaging 1.00
R5068:Mrc1 UTSW 2 14306516 missense probably benign 0.00
R5279:Mrc1 UTSW 2 14310058 missense probably damaging 0.99
R5366:Mrc1 UTSW 2 14321914 missense probably benign 0.03
R5436:Mrc1 UTSW 2 14266515 missense probably damaging 1.00
R5552:Mrc1 UTSW 2 14279957 missense probably benign 0.05
R5631:Mrc1 UTSW 2 14328572 nonsense probably null
R5831:Mrc1 UTSW 2 14308712 missense probably damaging 0.99
R5978:Mrc1 UTSW 2 14315393 missense probably damaging 0.97
R5993:Mrc1 UTSW 2 14305327 missense probably damaging 1.00
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6030:Mrc1 UTSW 2 14316901 missense probably benign 0.04
R6038:Mrc1 UTSW 2 14257071 missense probably damaging 1.00
R6038:Mrc1 UTSW 2 14257071 missense probably damaging 1.00
R6228:Mrc1 UTSW 2 14271304 missense probably benign 0.08
R6344:Mrc1 UTSW 2 14244174 missense probably damaging 1.00
R6457:Mrc1 UTSW 2 14270205 missense probably damaging 1.00
R6520:Mrc1 UTSW 2 14307949 missense probably damaging 1.00
R6619:Mrc1 UTSW 2 14294786 splice site probably null
R6631:Mrc1 UTSW 2 14238485 missense probably benign
R6737:Mrc1 UTSW 2 14271277 missense possibly damaging 0.95
R6782:Mrc1 UTSW 2 14261337 critical splice donor site probably null
R6887:Mrc1 UTSW 2 14325237 missense possibly damaging 0.94
R7108:Mrc1 UTSW 2 14304146 nonsense probably null
R7120:Mrc1 UTSW 2 14308697 missense probably damaging 0.97
R7460:Mrc1 UTSW 2 14248869 missense probably damaging 1.00
R7567:Mrc1 UTSW 2 14325293 missense probably damaging 1.00
R7606:Mrc1 UTSW 2 14238144 missense probably damaging 1.00
R7725:Mrc1 UTSW 2 14279977 missense probably benign 0.03
R7826:Mrc1 UTSW 2 14294857 missense probably damaging 1.00
R8082:Mrc1 UTSW 2 14248960 missense probably benign
R8279:Mrc1 UTSW 2 14266357 missense possibly damaging 0.89
Z1177:Mrc1 UTSW 2 14244138 missense probably damaging 1.00
Z1177:Mrc1 UTSW 2 14289116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCGATTCACAAGACTGGGGTTTCTC -3'
(R):5'- ACAGCAGCATTGTCAGGCATCATC -3'

Sequencing Primer
(F):5'- ACAAGACTGGGGTTTCTCATTTC -3'
(R):5'- ATTGTCAGGCATCATCGGAGC -3'
Posted On2013-06-12