Incidental Mutation 'R0539:Grm7'
ID49690
Institutional Source Beutler Lab
Gene Symbol Grm7
Ensembl Gene ENSMUSG00000056755
Gene Nameglutamate receptor, metabotropic 7
SynonymsGpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik
MMRRC Submission 038731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0539 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location110645581-111567230 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 111359094 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]
Predicted Effect probably benign
Transcript: ENSMUST00000071076
SMART Domains Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 3e-108 PFAM
Pfam:Peripla_BP_6 144 371 3e-11 PFAM
Pfam:NCD3G 519 569 1.2e-13 PFAM
Pfam:7tm_3 602 847 5.1e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172951
SMART Domains Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 484 1.7e-103 PFAM
Pfam:Peripla_BP_6 144 487 1e-12 PFAM
Pfam:NCD3G 519 569 1.2e-17 PFAM
Pfam:7tm_3 600 848 1.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174018
SMART Domains Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
Pfam:ANF_receptor 77 176 4.9e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik T A 5: 48,379,350 H129Q probably damaging Het
Abca14 G A 7: 120,207,797 R22Q probably damaging Het
Abcg5 T A 17: 84,669,075 M445L probably benign Het
Abhd3 T A 18: 10,645,208 N357I possibly damaging Het
Adamts5 C T 16: 85,868,692 G574S probably damaging Het
Adgrg5 T A 8: 94,938,632 N389K probably damaging Het
Ankk1 A G 9: 49,418,030 V80A probably benign Het
Arhgap20 A G 9: 51,850,155 Q1066R probably benign Het
Arhgap21 T A 2: 20,914,799 K32* probably null Het
AW209491 T C 13: 14,637,732 F390S probably damaging Het
Axl A T 7: 25,778,717 probably benign Het
Bri3bp A G 5: 125,454,539 Y183C probably damaging Het
Cad T C 5: 31,075,457 probably benign Het
Capns2 A G 8: 92,901,732 Q83R possibly damaging Het
Ccdc180 G T 4: 45,922,010 R1028L probably damaging Het
Cdh19 C A 1: 110,925,162 V348F possibly damaging Het
Chrm2 T C 6: 36,523,706 V166A possibly damaging Het
Clmp A G 9: 40,782,486 Y333C probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Copz1 A G 15: 103,291,365 Y69C probably damaging Het
Crybg1 T C 10: 43,998,898 D738G probably benign Het
Ctnna2 T A 6: 76,973,899 I165F probably damaging Het
Dcaf7 T G 11: 106,051,826 S200A probably damaging Het
Deup1 T A 9: 15,582,597 R416S possibly damaging Het
Dmxl1 T A 18: 49,857,430 probably benign Het
Dnase2b A T 3: 146,589,155 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Ephb2 T C 4: 136,655,976 Y931C probably damaging Het
Fam83h T C 15: 76,003,227 S754G possibly damaging Het
Fibp T A 19: 5,463,188 V177D probably damaging Het
Gfpt2 T C 11: 49,832,898 I571T probably damaging Het
Gsdma3 A G 11: 98,635,919 Y335C probably damaging Het
H2-T23 A T 17: 36,032,141 probably benign Het
Hist1h4c A G 13: 23,698,148 F101S probably damaging Het
Hydin A G 8: 110,523,072 I2216V probably benign Het
Ipo8 A G 6: 148,818,108 M113T probably benign Het
Kdm6a A G X: 18,262,425 E1045G probably damaging Het
Kyat1 C T 2: 30,188,217 E117K probably damaging Het
Lin7b A G 7: 45,369,902 probably benign Het
Lipn G A 19: 34,084,603 probably benign Het
Lrfn2 C A 17: 49,071,044 N384K probably damaging Het
Lrrc6 A T 15: 66,447,606 V305D probably damaging Het
Map1b T C 13: 99,434,018 K732E unknown Het
Mpl A G 4: 118,443,508 M541T possibly damaging Het
Mprip T C 11: 59,741,117 probably benign Het
Mrc1 T C 2: 14,270,126 probably benign Het
Ms4a13 T C 19: 11,171,871 probably benign Het
Myo18b G T 5: 112,723,868 R2116S probably damaging Het
Nav2 A G 7: 49,461,938 T731A probably damaging Het
Ncoa6 G T 2: 155,415,697 A642D probably benign Het
Ndufs7 T A 10: 80,254,831 probably benign Het
Nfkbiz G A 16: 55,817,879 T406M probably benign Het
Nr4a1 A G 15: 101,270,884 E267G probably damaging Het
Nrxn2 T G 19: 6,493,404 F1103V probably damaging Het
Olfr1028 G T 2: 85,952,009 M315I probably benign Het
Olfr1044 A T 2: 86,171,043 M258K probably damaging Het
Olfr1441 C T 19: 12,422,809 L167F probably damaging Het
Olfr381 T C 11: 73,486,063 T254A probably benign Het
Olfr479 C T 7: 108,055,822 T280I probably damaging Het
Olfr958 A T 9: 39,550,297 D191E probably damaging Het
Olfr996 T A 2: 85,579,775 C179S probably damaging Het
Phf1 A G 17: 26,934,458 probably null Het
Pip C T 6: 41,849,885 Q53* probably null Het
Ppp2ca T C 11: 52,118,162 probably null Het
Prl2c5 A G 13: 13,189,321 probably null Het
Psph T A 5: 129,766,577 probably benign Het
Ptch1 C T 13: 63,543,480 probably benign Het
Ptprs C T 17: 56,458,255 V10M probably damaging Het
Rarg T C 15: 102,238,877 R358G probably damaging Het
Rbl2 T C 8: 91,112,505 probably benign Het
Robo2 A T 16: 73,985,574 probably benign Het
Scin A T 12: 40,081,766 D256E possibly damaging Het
Scn8a T C 15: 101,016,568 Y1152H probably damaging Het
Sh2b2 T G 5: 136,225,301 probably benign Het
Slc13a2 G A 11: 78,399,138 P450L probably damaging Het
Slc2a12 A G 10: 22,692,230 I519V probably benign Het
Slc30a9 C T 5: 67,334,610 T260M probably damaging Het
Slc9a7 A T X: 20,202,762 F184Y probably damaging Het
Smc2 G T 4: 52,458,558 K466N probably benign Het
Snx16 T C 3: 10,426,218 E209G probably damaging Het
Sp3 A T 2: 72,970,532 I423N possibly damaging Het
Ssh2 G T 11: 77,454,794 V1202F probably benign Het
Stam2 A T 2: 52,703,256 probably benign Het
Stox2 T C 8: 47,194,035 Y194C probably damaging Het
Sult3a1 A G 10: 33,866,523 T49A probably damaging Het
Supt3 A T 17: 45,003,131 I136F possibly damaging Het
Syne2 A T 12: 76,024,121 R103S possibly damaging Het
Synj2 T A 17: 5,996,888 M1K probably null Het
Tas2r110 T C 6: 132,868,371 S122P possibly damaging Het
Tln1 A G 4: 43,543,434 probably null Het
Tmem117 A G 15: 94,714,912 T110A possibly damaging Het
Tmem247 A G 17: 86,917,478 D5G probably benign Het
Tmem39a T A 16: 38,590,975 F363I probably benign Het
Tmem80 G A 7: 141,335,895 A73T possibly damaging Het
Trpm4 C T 7: 45,305,472 G901S probably damaging Het
Upk3bl T C 5: 136,063,986 probably benign Het
Vmn1r120 A T 7: 21,053,472 C105S probably damaging Het
Vmn1r69 A T 7: 10,580,947 probably benign Het
Vmn2r95 T C 17: 18,452,100 F700L probably damaging Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Zbtb22 A G 17: 33,918,144 D421G possibly damaging Het
Zbtb45 G A 7: 13,006,333 R452C probably damaging Het
Zfhx3 T C 8: 108,800,509 Y1013H probably damaging Het
Zfp329 C T 7: 12,806,593 probably null Het
Zfp532 T A 18: 65,623,766 S257T probably benign Het
Zfp933 G A 4: 147,826,548 T197I probably benign Het
Zgrf1 T A 3: 127,615,192 N1649K probably damaging Het
Other mutations in Grm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Grm7 APN 6 111246184 missense probably benign 0.14
IGL02058:Grm7 APN 6 111358317 missense probably damaging 1.00
IGL02650:Grm7 APN 6 111358958 missense probably damaging 1.00
IGL02892:Grm7 APN 6 111254020 missense probably damaging 0.99
IGL03074:Grm7 APN 6 111495643 splice site probably null
IGL03185:Grm7 APN 6 110646222 missense possibly damaging 0.84
Appropriated UTSW 6 111495681 missense possibly damaging 0.64
Consumed UTSW 6 111358875 missense probably damaging 1.00
Devoured UTSW 6 111358824 missense probably damaging 1.00
shaky UTSW 6 111495791 nonsense probably null
PIT4651001:Grm7 UTSW 6 110646089 missense probably benign
R0622:Grm7 UTSW 6 111358496 missense probably damaging 1.00
R1356:Grm7 UTSW 6 111359024 missense probably damaging 1.00
R1762:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1783:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1785:Grm7 UTSW 6 111358295 missense probably damaging 1.00
R1816:Grm7 UTSW 6 111495791 nonsense probably null
R1823:Grm7 UTSW 6 111207769 missense probably benign 0.17
R1864:Grm7 UTSW 6 111080423 missense probably benign 0.03
R1894:Grm7 UTSW 6 111358607 missense probably benign
R1987:Grm7 UTSW 6 110914511 missense probably damaging 1.00
R1993:Grm7 UTSW 6 111207808 missense probably benign 0.13
R2138:Grm7 UTSW 6 110646137 missense probably damaging 1.00
R2214:Grm7 UTSW 6 111358997 missense probably damaging 1.00
R2289:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2296:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2339:Grm7 UTSW 6 111495681 missense possibly damaging 0.64
R2847:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2849:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2879:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2884:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R2921:Grm7 UTSW 6 111495905 splice site probably null
R2923:Grm7 UTSW 6 111495905 splice site probably null
R3014:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3015:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3703:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3713:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R3963:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4009:Grm7 UTSW 6 111495722 missense probably damaging 1.00
R4091:Grm7 UTSW 6 110914340 missense probably damaging 1.00
R4131:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4132:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4161:Grm7 UTSW 6 111254020 missense probably damaging 0.99
R4329:Grm7 UTSW 6 110914364 missense probably damaging 1.00
R4357:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4359:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4379:Grm7 UTSW 6 111246374 missense probably benign 0.05
R4380:Grm7 UTSW 6 110646348 missense probably damaging 1.00
R4514:Grm7 UTSW 6 111358304 missense possibly damaging 0.81
R4518:Grm7 UTSW 6 110914546 splice site probably null
R4647:Grm7 UTSW 6 110914383 nonsense probably null
R4714:Grm7 UTSW 6 111080422 missense possibly damaging 0.52
R4775:Grm7 UTSW 6 110914371 missense probably damaging 1.00
R4957:Grm7 UTSW 6 111358863 missense probably damaging 1.00
R5056:Grm7 UTSW 6 111080443 missense probably damaging 0.99
R5062:Grm7 UTSW 6 110646136 missense probably damaging 1.00
R5256:Grm7 UTSW 6 111358221 missense probably benign 0.01
R5431:Grm7 UTSW 6 111358426 missense probably benign
R6026:Grm7 UTSW 6 111501539 nonsense probably null
R6174:Grm7 UTSW 6 111246297 missense probably benign
R6305:Grm7 UTSW 6 111358665 missense probably damaging 1.00
R6318:Grm7 UTSW 6 111358875 missense probably damaging 1.00
R6440:Grm7 UTSW 6 111254020 missense probably damaging 1.00
R6519:Grm7 UTSW 6 111207752 missense probably benign 0.00
R6531:Grm7 UTSW 6 111358425 missense probably benign 0.29
R6888:Grm7 UTSW 6 111358353 missense possibly damaging 0.79
R6949:Grm7 UTSW 6 110646304 missense probably benign 0.03
R6949:Grm7 UTSW 6 111495729 missense probably damaging 1.00
R6989:Grm7 UTSW 6 111207805 missense probably damaging 1.00
R7076:Grm7 UTSW 6 111358152 missense probably benign 0.04
R7203:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7208:Grm7 UTSW 6 111358569 missense possibly damaging 0.94
R7217:Grm7 UTSW 6 111358824 missense probably damaging 1.00
R7257:Grm7 UTSW 6 110646118 missense probably damaging 1.00
R7297:Grm7 UTSW 6 110646013 missense probably benign 0.16
R7470:Grm7 UTSW 6 111501515 missense
R7567:Grm7 UTSW 6 111358761 missense probably damaging 0.96
R7806:Grm7 UTSW 6 111246353 nonsense probably null
R8018:Grm7 UTSW 6 111207776 missense probably benign 0.01
R8076:Grm7 UTSW 6 111566039 missense probably damaging 1.00
R8409:Grm7 UTSW 6 110914336 missense probably benign 0.02
R8420:Grm7 UTSW 6 111080354 missense probably benign
Z1176:Grm7 UTSW 6 111358149 missense probably benign 0.01
Z1176:Grm7 UTSW 6 111358490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTGACAGCTCCCAGACTCATAAG -3'
(R):5'- GCCTACTGAAAATTCTAGACTCCTGCTC -3'

Sequencing Primer
(F):5'- GGAGTTCTCAAATGTGACATCACAG -3'
(R):5'- TCCCTTTGGAGGACACAATC -3'
Posted On2013-06-12