Incidental Mutation 'R0539:Map1b'
ID 49732
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, MAP5, Mtap-5, Mtap5, LC1
MMRRC Submission 038731-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0539 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 99421446-99516540 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99434018 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 732 (K732E)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: K732E
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: K732E

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (107/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730480H06Rik T A 5: 48,379,350 H129Q probably damaging Het
Abca14 G A 7: 120,207,797 R22Q probably damaging Het
Abcg5 T A 17: 84,669,075 M445L probably benign Het
Abhd3 T A 18: 10,645,208 N357I possibly damaging Het
Adamts5 C T 16: 85,868,692 G574S probably damaging Het
Adgrg5 T A 8: 94,938,632 N389K probably damaging Het
Ankk1 A G 9: 49,418,030 V80A probably benign Het
Arhgap20 A G 9: 51,850,155 Q1066R probably benign Het
Arhgap21 T A 2: 20,914,799 K32* probably null Het
AW209491 T C 13: 14,637,732 F390S probably damaging Het
Axl A T 7: 25,778,717 probably benign Het
Bri3bp A G 5: 125,454,539 Y183C probably damaging Het
Cad T C 5: 31,075,457 probably benign Het
Capns2 A G 8: 92,901,732 Q83R possibly damaging Het
Ccdc180 G T 4: 45,922,010 R1028L probably damaging Het
Cdh19 C A 1: 110,925,162 V348F possibly damaging Het
Chrm2 T C 6: 36,523,706 V166A possibly damaging Het
Clmp A G 9: 40,782,486 Y333C probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Copz1 A G 15: 103,291,365 Y69C probably damaging Het
Crybg1 T C 10: 43,998,898 D738G probably benign Het
Ctnna2 T A 6: 76,973,899 I165F probably damaging Het
Dcaf7 T G 11: 106,051,826 S200A probably damaging Het
Deup1 T A 9: 15,582,597 R416S possibly damaging Het
Dmxl1 T A 18: 49,857,430 probably benign Het
Dnase2b A T 3: 146,589,155 probably benign Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eef2 C CN 10: 81,178,768 probably null Het
Ephb2 T C 4: 136,655,976 Y931C probably damaging Het
Fam83h T C 15: 76,003,227 S754G possibly damaging Het
Fibp T A 19: 5,463,188 V177D probably damaging Het
Gfpt2 T C 11: 49,832,898 I571T probably damaging Het
Grm7 T G 6: 111,359,094 probably benign Het
Gsdma3 A G 11: 98,635,919 Y335C probably damaging Het
H2-T23 A T 17: 36,032,141 probably benign Het
Hist1h4c A G 13: 23,698,148 F101S probably damaging Het
Hydin A G 8: 110,523,072 I2216V probably benign Het
Ipo8 A G 6: 148,818,108 M113T probably benign Het
Kdm6a A G X: 18,262,425 E1045G probably damaging Het
Kyat1 C T 2: 30,188,217 E117K probably damaging Het
Lin7b A G 7: 45,369,902 probably benign Het
Lipn G A 19: 34,084,603 probably benign Het
Lrfn2 C A 17: 49,071,044 N384K probably damaging Het
Lrrc6 A T 15: 66,447,606 V305D probably damaging Het
Mpl A G 4: 118,443,508 M541T possibly damaging Het
Mprip T C 11: 59,741,117 probably benign Het
Mrc1 T C 2: 14,270,126 probably benign Het
Ms4a13 T C 19: 11,171,871 probably benign Het
Myo18b G T 5: 112,723,868 R2116S probably damaging Het
Nav2 A G 7: 49,461,938 T731A probably damaging Het
Ncoa6 G T 2: 155,415,697 A642D probably benign Het
Ndufs7 T A 10: 80,254,831 probably benign Het
Nfkbiz G A 16: 55,817,879 T406M probably benign Het
Nr4a1 A G 15: 101,270,884 E267G probably damaging Het
Nrxn2 T G 19: 6,493,404 F1103V probably damaging Het
Olfr1028 G T 2: 85,952,009 M315I probably benign Het
Olfr1044 A T 2: 86,171,043 M258K probably damaging Het
Olfr1441 C T 19: 12,422,809 L167F probably damaging Het
Olfr381 T C 11: 73,486,063 T254A probably benign Het
Olfr479 C T 7: 108,055,822 T280I probably damaging Het
Olfr958 A T 9: 39,550,297 D191E probably damaging Het
Olfr996 T A 2: 85,579,775 C179S probably damaging Het
Phf1 A G 17: 26,934,458 probably null Het
Pip C T 6: 41,849,885 Q53* probably null Het
Ppp2ca T C 11: 52,118,162 probably null Het
Prl2c5 A G 13: 13,189,321 probably null Het
Psph T A 5: 129,766,577 probably benign Het
Ptch1 C T 13: 63,543,480 probably benign Het
Ptprs C T 17: 56,458,255 V10M probably damaging Het
Rarg T C 15: 102,238,877 R358G probably damaging Het
Rbl2 T C 8: 91,112,505 probably benign Het
Robo2 A T 16: 73,985,574 probably benign Het
Scin A T 12: 40,081,766 D256E possibly damaging Het
Scn8a T C 15: 101,016,568 Y1152H probably damaging Het
Sh2b2 T G 5: 136,225,301 probably benign Het
Slc13a2 G A 11: 78,399,138 P450L probably damaging Het
Slc2a12 A G 10: 22,692,230 I519V probably benign Het
Slc30a9 C T 5: 67,334,610 T260M probably damaging Het
Slc9a7 A T X: 20,202,762 F184Y probably damaging Het
Smc2 G T 4: 52,458,558 K466N probably benign Het
Snx16 T C 3: 10,426,218 E209G probably damaging Het
Sp3 A T 2: 72,970,532 I423N possibly damaging Het
Ssh2 G T 11: 77,454,794 V1202F probably benign Het
Stam2 A T 2: 52,703,256 probably benign Het
Stox2 T C 8: 47,194,035 Y194C probably damaging Het
Sult3a1 A G 10: 33,866,523 T49A probably damaging Het
Supt3 A T 17: 45,003,131 I136F possibly damaging Het
Syne2 A T 12: 76,024,121 R103S possibly damaging Het
Synj2 T A 17: 5,996,888 M1K probably null Het
Tas2r110 T C 6: 132,868,371 S122P possibly damaging Het
Tln1 A G 4: 43,543,434 probably null Het
Tmem117 A G 15: 94,714,912 T110A possibly damaging Het
Tmem247 A G 17: 86,917,478 D5G probably benign Het
Tmem39a T A 16: 38,590,975 F363I probably benign Het
Tmem80 G A 7: 141,335,895 A73T possibly damaging Het
Trpm4 C T 7: 45,305,472 G901S probably damaging Het
Upk3bl T C 5: 136,063,986 probably benign Het
Vmn1r120 A T 7: 21,053,472 C105S probably damaging Het
Vmn1r69 A T 7: 10,580,947 probably benign Het
Vmn2r95 T C 17: 18,452,100 F700L probably damaging Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Zbtb22 A G 17: 33,918,144 D421G possibly damaging Het
Zbtb45 G A 7: 13,006,333 R452C probably damaging Het
Zfhx3 T C 8: 108,800,509 Y1013H probably damaging Het
Zfp329 C T 7: 12,806,593 probably null Het
Zfp532 T A 18: 65,623,766 S257T probably benign Het
Zfp933 G A 4: 147,826,548 T197I probably benign Het
Zgrf1 T A 3: 127,615,192 N1649K probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99429233 missense unknown
IGL00533:Map1b APN 13 99432604 missense unknown
IGL00801:Map1b APN 13 99430097 missense unknown
IGL01141:Map1b APN 13 99434761 missense probably damaging 1.00
IGL01418:Map1b APN 13 99431830 missense unknown
IGL01464:Map1b APN 13 99432743 missense unknown
IGL01690:Map1b APN 13 99435004 missense probably damaging 1.00
IGL01991:Map1b APN 13 99429569 missense unknown
IGL02245:Map1b APN 13 99431528 missense unknown
IGL02376:Map1b APN 13 99435595 missense probably damaging 1.00
IGL02380:Map1b APN 13 99431143 missense unknown
IGL02442:Map1b APN 13 99508198 missense probably damaging 1.00
IGL02465:Map1b APN 13 99433406 missense unknown
IGL02816:Map1b APN 13 99441755 missense probably damaging 1.00
IGL02859:Map1b APN 13 99433036 missense unknown
IGL02934:Map1b APN 13 99435131 missense probably benign 0.09
IGL02970:Map1b APN 13 99430734 nonsense probably null
IGL03148:Map1b APN 13 99441695 missense probably damaging 1.00
IGL03401:Map1b APN 13 99427268 missense unknown
IGL03138:Map1b UTSW 13 99425826 missense unknown
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0006:Map1b UTSW 13 99435302 missense probably damaging 1.00
R0035:Map1b UTSW 13 99435338 missense probably damaging 1.00
R0069:Map1b UTSW 13 99429848 missense unknown
R0315:Map1b UTSW 13 99431116 missense unknown
R0548:Map1b UTSW 13 99431683 missense unknown
R0613:Map1b UTSW 13 99441641 missense probably damaging 1.00
R0730:Map1b UTSW 13 99429766 nonsense probably null
R1103:Map1b UTSW 13 99427466 splice site probably benign
R1300:Map1b UTSW 13 99432521 missense unknown
R1353:Map1b UTSW 13 99427326 missense unknown
R1387:Map1b UTSW 13 99432650 missense unknown
R1481:Map1b UTSW 13 99431171 missense unknown
R1509:Map1b UTSW 13 99431528 missense unknown
R1521:Map1b UTSW 13 99432739 missense unknown
R1604:Map1b UTSW 13 99429572 missense unknown
R1649:Map1b UTSW 13 99516478 missense probably benign 0.03
R1651:Map1b UTSW 13 99432583 missense unknown
R1661:Map1b UTSW 13 99431929 missense unknown
R1665:Map1b UTSW 13 99431929 missense unknown
R1770:Map1b UTSW 13 99430493 missense unknown
R1926:Map1b UTSW 13 99430692 missense unknown
R1928:Map1b UTSW 13 99430946 missense unknown
R2093:Map1b UTSW 13 99429670 missense unknown
R2110:Map1b UTSW 13 99431121 missense unknown
R2116:Map1b UTSW 13 99430644 missense unknown
R2164:Map1b UTSW 13 99429338 missense unknown
R2207:Map1b UTSW 13 99431083 missense unknown
R2273:Map1b UTSW 13 99432084 missense unknown
R2443:Map1b UTSW 13 99430411 missense unknown
R3054:Map1b UTSW 13 99432742 missense unknown
R3766:Map1b UTSW 13 99434087 missense unknown
R3911:Map1b UTSW 13 99431072 missense unknown
R4005:Map1b UTSW 13 99429907 missense unknown
R4130:Map1b UTSW 13 99431680 missense unknown
R4513:Map1b UTSW 13 99444233 missense probably damaging 1.00
R4613:Map1b UTSW 13 99430302 nonsense probably null
R4633:Map1b UTSW 13 99434942 missense probably damaging 1.00
R4646:Map1b UTSW 13 99432469 missense unknown
R4690:Map1b UTSW 13 99431068 missense unknown
R4704:Map1b UTSW 13 99430475 missense unknown
R4836:Map1b UTSW 13 99431054 missense unknown
R4916:Map1b UTSW 13 99433300 missense unknown
R4951:Map1b UTSW 13 99432427 missense unknown
R4960:Map1b UTSW 13 99432212 missense probably benign 0.23
R4961:Map1b UTSW 13 99435653 missense probably damaging 1.00
R5030:Map1b UTSW 13 99434174 missense unknown
R5090:Map1b UTSW 13 99430026 nonsense probably null
R5469:Map1b UTSW 13 99429338 missense unknown
R5820:Map1b UTSW 13 99432824 missense unknown
R5885:Map1b UTSW 13 99430081 missense unknown
R5915:Map1b UTSW 13 99430331 missense unknown
R5923:Map1b UTSW 13 99433153 missense unknown
R6063:Map1b UTSW 13 99431137 missense unknown
R6102:Map1b UTSW 13 99425873 missense unknown
R6218:Map1b UTSW 13 99433206 missense unknown
R6435:Map1b UTSW 13 99516363 missense probably damaging 0.99
R6663:Map1b UTSW 13 99430022 missense unknown
R6765:Map1b UTSW 13 99425941 missense unknown
R6860:Map1b UTSW 13 99434767 missense probably damaging 1.00
R6997:Map1b UTSW 13 99430634 missense unknown
R7001:Map1b UTSW 13 99430593 missense unknown
R7310:Map1b UTSW 13 99433655 missense unknown
R7349:Map1b UTSW 13 99433640 missense unknown
R7448:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7449:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7452:Map1b UTSW 13 99508140 missense probably damaging 0.99
R7810:Map1b UTSW 13 99431882 missense unknown
R7820:Map1b UTSW 13 99431177 missense unknown
R8396:Map1b UTSW 13 99434113 missense unknown
R8470:Map1b UTSW 13 99516442 missense probably damaging 0.98
R8535:Map1b UTSW 13 99435154 missense probably damaging 1.00
R8777:Map1b UTSW 13 99430796 missense unknown
R8777-TAIL:Map1b UTSW 13 99430796 missense unknown
R8812:Map1b UTSW 13 99432815 missense unknown
R8903:Map1b UTSW 13 99432509 nonsense probably null
R8928:Map1b UTSW 13 99432116 missense unknown
R8954:Map1b UTSW 13 99434227 missense unknown
R9164:Map1b UTSW 13 99425843 missense unknown
R9164:Map1b UTSW 13 99432308 nonsense probably null
R9190:Map1b UTSW 13 99435406 missense probably damaging 0.99
R9334:Map1b UTSW 13 99431640 missense unknown
R9339:Map1b UTSW 13 99431062 missense unknown
R9357:Map1b UTSW 13 99430200 nonsense probably null
R9430:Map1b UTSW 13 99434108 missense unknown
RF003:Map1b UTSW 13 99430750 missense unknown
X0019:Map1b UTSW 13 99429968 missense unknown
X0019:Map1b UTSW 13 99432412 missense unknown
Z1088:Map1b UTSW 13 99508115 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGTTCTTTGACAGGACCACTGGC -3'
(R):5'- TCCAAGGAGGAAACCCCTGAAGTC -3'

Sequencing Primer
(F):5'- AGCTGCTTCtgtggtcttg -3'
(R):5'- caaaacacccctcaagaaagac -3'
Posted On 2013-06-12